Incidental Mutation 'R0825:Pcdhb2'
ID78203
Institutional Source Beutler Lab
Gene Symbol Pcdhb2
Ensembl Gene ENSMUSG00000051599
Gene Nameprotocadherin beta 2
SynonymsPcdhbB
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R0825 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37294812-37297624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37295657 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 228 (V228I)
Ref Sequence ENSEMBL: ENSMUSP00000057921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056522] [ENSMUST00000115661] [ENSMUST00000193137] [ENSMUST00000194544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056522
AA Change: V228I

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000057921
Gene: ENSMUSG00000051599
AA Change: V228I

DomainStartEndE-ValueType
Pfam:Cadherin_2 32 114 5.2e-33 PFAM
CA 157 242 1.74e-19 SMART
CA 266 347 5.99e-23 SMART
CA 370 451 1.16e-20 SMART
CA 475 561 5.94e-27 SMART
CA 591 672 2.03e-11 SMART
Pfam:Cadherin_C_2 688 771 3.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193137
SMART Domains Protein: ENSMUSP00000141439
Gene: ENSMUSG00000051599

DomainStartEndE-ValueType
CA 13 94 1.8e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Aox4 A G 1: 58,248,909 D727G possibly damaging Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Gfm2 A T 13: 97,143,104 probably benign Het
Ghsr T C 3: 27,374,627 V267A probably damaging Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Hmgcl A G 4: 135,960,070 T219A probably benign Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Nt5c2 A G 19: 46,898,905 probably benign Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Olfr199 G T 16: 59,216,450 H54Q possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Rnf217 T C 10: 31,517,457 D376G probably damaging Het
Sept9 C T 11: 117,359,460 L519F probably damaging Het
Slc15a5 C T 6: 138,018,089 C386Y possibly damaging Het
Srrm4 T A 5: 116,453,713 I256F unknown Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Strbp A T 2: 37,635,527 N144K probably benign Het
Sync A G 4: 129,293,397 Y74C probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tgfbi T C 13: 56,638,710 probably benign Het
Tmf1 A T 6: 97,175,995 N372K probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Pcdhb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Pcdhb2 APN 18 37296463 splice site probably null
IGL01538:Pcdhb2 APN 18 37295322 nonsense probably null
IGL01716:Pcdhb2 APN 18 37296738 missense probably damaging 0.99
IGL01747:Pcdhb2 APN 18 37296303 missense probably damaging 1.00
IGL01770:Pcdhb2 APN 18 37296303 missense probably damaging 1.00
IGL01999:Pcdhb2 APN 18 37296837 missense probably damaging 1.00
IGL02174:Pcdhb2 APN 18 37296498 missense probably damaging 1.00
IGL02325:Pcdhb2 APN 18 37296680 missense possibly damaging 0.91
IGL03148:Pcdhb2 APN 18 37296778 missense probably damaging 1.00
IGL03263:Pcdhb2 APN 18 37296006 missense probably damaging 1.00
R0158:Pcdhb2 UTSW 18 37297230 missense probably damaging 1.00
R0512:Pcdhb2 UTSW 18 37295979 missense probably damaging 1.00
R0656:Pcdhb2 UTSW 18 37295490 missense probably damaging 1.00
R0670:Pcdhb2 UTSW 18 37296648 missense probably damaging 1.00
R0698:Pcdhb2 UTSW 18 37297366 missense probably benign 0.00
R0827:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R0862:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R0863:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R1344:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R1440:Pcdhb2 UTSW 18 37296290 missense probably benign 0.22
R1826:Pcdhb2 UTSW 18 37295985 missense probably damaging 0.99
R1828:Pcdhb2 UTSW 18 37295985 missense probably damaging 0.99
R1869:Pcdhb2 UTSW 18 37297355 splice site probably null
R1871:Pcdhb2 UTSW 18 37297355 splice site probably null
R2292:Pcdhb2 UTSW 18 37297244 splice site probably null
R3743:Pcdhb2 UTSW 18 37296417 missense probably damaging 1.00
R4067:Pcdhb2 UTSW 18 37297314 splice site probably null
R4127:Pcdhb2 UTSW 18 37295541 missense probably damaging 0.97
R4402:Pcdhb2 UTSW 18 37295402 missense probably benign 0.05
R4579:Pcdhb2 UTSW 18 37296115 missense probably damaging 1.00
R4621:Pcdhb2 UTSW 18 37295927 missense probably benign 0.44
R4678:Pcdhb2 UTSW 18 37296207 missense probably damaging 1.00
R5143:Pcdhb2 UTSW 18 37296732 missense probably damaging 1.00
R5152:Pcdhb2 UTSW 18 37296126 missense probably damaging 0.97
R6552:Pcdhb2 UTSW 18 37295993 missense probably benign
R6908:Pcdhb2 UTSW 18 37296524 missense probably damaging 1.00
R6973:Pcdhb2 UTSW 18 37296363 missense probably benign 0.03
R7143:Pcdhb2 UTSW 18 37295881 missense probably benign 0.05
R7248:Pcdhb2 UTSW 18 37296494 missense probably damaging 1.00
R7586:Pcdhb2 UTSW 18 37295804 nonsense probably null
R7634:Pcdhb2 UTSW 18 37294947 intron probably benign
R7796:Pcdhb2 UTSW 18 37295393 missense possibly damaging 0.63
R7862:Pcdhb2 UTSW 18 37296060 missense probably benign 0.25
R8415:Pcdhb2 UTSW 18 37296057 missense probably damaging 0.97
R8950:Pcdhb2 UTSW 18 37296662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGCAACGGTCTCCAAACTTAC -3'
(R):5'- CCGGATGTTGCATTCATTCGAAACG -3'

Sequencing Primer
(F):5'- CGGTCTCCAAACTTACACAATC -3'
(R):5'- ACGTTTTCCGAATGTCTTCAGAG -3'
Posted On2013-10-16