Incidental Mutation 'R0825:Nt5c2'
ID78204
Institutional Source Beutler Lab
Gene Symbol Nt5c2
Ensembl Gene ENSMUSG00000025041
Gene Name5'-nucleotidase, cytosolic II
SynonymsPNT5, NT5B, cN-II
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R0825 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location46886831-47015153 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 46898905 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000086961] [ENSMUST00000168536] [ENSMUST00000172239]
Predicted Effect probably benign
Transcript: ENSMUST00000086961
SMART Domains Protein: ENSMUSP00000084180
Gene: ENSMUSG00000025041

DomainStartEndE-ValueType
Pfam:5_nucleotid 60 518 3.5e-185 PFAM
low complexity region 574 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168536
SMART Domains Protein: ENSMUSP00000129126
Gene: ENSMUSG00000025041

DomainStartEndE-ValueType
Pfam:5_nucleotid 35 493 1.6e-185 PFAM
low complexity region 549 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172239
SMART Domains Protein: ENSMUSP00000130898
Gene: ENSMUSG00000025041

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
Pfam:5_nucleotid 61 515 6.5e-179 PFAM
low complexity region 575 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174731
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hydrolase that serves as an important role in cellular purine metabolism by acting primarily on inosine 5'-monophosphate and other purine nucleotides. [provided by RefSeq, Oct 2011]
PHENOTYPE: Bone marrow cells with a nucleotide substitution allele used in a transplantation experiment following tamoxifen-induction produce NOTCH1-induced tumors that are resistant to 6-mercaptopurine chemotherapy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Aox4 A G 1: 58,248,909 D727G possibly damaging Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Gfm2 A T 13: 97,143,104 probably benign Het
Ghsr T C 3: 27,374,627 V267A probably damaging Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Hmgcl A G 4: 135,960,070 T219A probably benign Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Olfr199 G T 16: 59,216,450 H54Q possibly damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Rnf217 T C 10: 31,517,457 D376G probably damaging Het
Sept9 C T 11: 117,359,460 L519F probably damaging Het
Slc15a5 C T 6: 138,018,089 C386Y possibly damaging Het
Srrm4 T A 5: 116,453,713 I256F unknown Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Strbp A T 2: 37,635,527 N144K probably benign Het
Sync A G 4: 129,293,397 Y74C probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tgfbi T C 13: 56,638,710 probably benign Het
Tmf1 A T 6: 97,175,995 N372K probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Nt5c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Nt5c2 APN 19 46896515 missense possibly damaging 0.91
IGL00814:Nt5c2 APN 19 46897648 missense probably benign 0.02
IGL02347:Nt5c2 APN 19 46924256 splice site probably benign
IGL02630:Nt5c2 APN 19 46924310 missense probably benign 0.00
tightrope UTSW 19 46924327 missense probably damaging 1.00
R0565:Nt5c2 UTSW 19 46897625 missense probably damaging 0.99
R0980:Nt5c2 UTSW 19 46898878 missense probably benign
R1496:Nt5c2 UTSW 19 46904978 missense probably damaging 1.00
R2394:Nt5c2 UTSW 19 46890067 critical splice donor site probably null
R3854:Nt5c2 UTSW 19 46896518 missense probably damaging 1.00
R3855:Nt5c2 UTSW 19 46896518 missense probably damaging 1.00
R3856:Nt5c2 UTSW 19 46896518 missense probably damaging 1.00
R4534:Nt5c2 UTSW 19 46891661 missense probably damaging 1.00
R4907:Nt5c2 UTSW 19 46896539 missense possibly damaging 0.71
R5122:Nt5c2 UTSW 19 46889921 missense probably damaging 1.00
R5203:Nt5c2 UTSW 19 46889808 missense probably damaging 1.00
R5226:Nt5c2 UTSW 19 46898629 missense probably damaging 1.00
R5254:Nt5c2 UTSW 19 46893560 nonsense probably null
R5315:Nt5c2 UTSW 19 46892243 missense probably damaging 1.00
R6401:Nt5c2 UTSW 19 46889811 missense probably benign 0.11
R6784:Nt5c2 UTSW 19 46924327 missense probably damaging 1.00
R7040:Nt5c2 UTSW 19 46893535 missense possibly damaging 0.52
R7414:Nt5c2 UTSW 19 46889889 missense probably damaging 1.00
R7792:Nt5c2 UTSW 19 46889946 missense probably benign 0.02
R7793:Nt5c2 UTSW 19 46891581 missense probably benign 0.23
X0028:Nt5c2 UTSW 19 46891615 missense probably damaging 1.00
X0065:Nt5c2 UTSW 19 46890088 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACTCAGCTTCCTGGAAGACATGGC -3'
(R):5'- AGCACCTGTTCATGCATTAGTCTCC -3'

Sequencing Primer
(F):5'- AAGACATGGCCCTGGAAC -3'
(R):5'- ctgttcatgcattagtctccTTAAAC -3'
Posted On2013-10-16