Incidental Mutation 'R0826:Col19a1'
ID78205
Institutional Source Beutler Lab
Gene Symbol Col19a1
Ensembl Gene ENSMUSG00000026141
Gene Namecollagen, type XIX, alpha 1
Synonyms
MMRRC Submission 039006-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0826 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location24261890-24587472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24526386 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 288 (K288R)
Ref Sequence ENSEMBL: ENSMUSP00000110899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051344] [ENSMUST00000115244]
Predicted Effect unknown
Transcript: ENSMUST00000051344
AA Change: K288R
SMART Domains Protein: ENSMUSP00000052606
Gene: ENSMUSG00000026141
AA Change: K288R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 349 1e-9 PFAM
Pfam:Collagen 325 391 2.2e-10 PFAM
Pfam:Collagen 376 442 1.4e-8 PFAM
Pfam:Collagen 436 500 2.9e-9 PFAM
Pfam:Collagen 474 536 6.3e-10 PFAM
Pfam:Collagen 519 579 5.6e-10 PFAM
Pfam:Collagen 559 620 1.2e-8 PFAM
Pfam:Collagen 619 675 8.7e-11 PFAM
Pfam:Collagen 697 774 2.4e-8 PFAM
Pfam:Collagen 753 819 8.7e-10 PFAM
Pfam:Collagen 831 892 8.8e-12 PFAM
internal_repeat_2 905 943 3.52e-11 PROSPERO
internal_repeat_1 905 980 8.61e-26 PROSPERO
internal_repeat_2 947 982 3.52e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115244
AA Change: K288R
SMART Domains Protein: ENSMUSP00000110899
Gene: ENSMUSG00000026141
AA Change: K288R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 347 3.1e-9 PFAM
Pfam:Collagen 330 391 1.1e-9 PFAM
internal_repeat_4 455 492 1.88e-5 PROSPERO
Pfam:Collagen 519 579 2e-9 PFAM
Pfam:Collagen 559 620 4.9e-8 PFAM
Pfam:Collagen 619 675 3.5e-10 PFAM
low complexity region 723 741 N/A INTRINSIC
Pfam:Collagen 753 819 2.8e-9 PFAM
Pfam:Collagen 831 892 3.9e-11 PFAM
internal_repeat_2 905 943 1.18e-11 PROSPERO
internal_repeat_1 905 980 8.89e-27 PROSPERO
internal_repeat_2 947 982 1.18e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1048 1069 N/A INTRINSIC
low complexity region 1078 1115 N/A INTRINSIC
Meta Mutation Damage Score 0.0751 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIX collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Although the function of this collagen is not known, other members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. The transcript produced from this gene has an unusually large 3' UTR which has not been completely sequenced. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality resulting from impaired swallowing, abnormal esophageal muscle development, and impaired muscle relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930563D23Rik G A 16: 92,321,187 S71L probably benign Het
4931406C07Rik T C 9: 15,291,996 probably null Het
Adamts16 T A 13: 70,768,692 D727V possibly damaging Het
Anxa10 A C 8: 62,076,284 L133* probably null Het
Arfgef3 G A 10: 18,589,666 T2143I probably damaging Het
Arhgef17 T C 7: 100,930,743 T333A probably benign Het
Arhgef40 A G 14: 52,000,993 T1310A probably benign Het
Atg10 C T 13: 90,936,586 probably null Het
Atp1a1 A G 3: 101,584,853 F569S probably damaging Het
Baiap3 A G 17: 25,245,229 W849R possibly damaging Het
Baz1a A T 12: 54,930,312 Y9* probably null Het
Catsperg2 C T 7: 29,705,624 D702N possibly damaging Het
Clasrp G T 7: 19,584,301 probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cttnbp2 A G 6: 18,405,178 probably benign Het
Dnah1 T A 14: 31,303,907 I828F probably benign Het
Dpf2 G T 19: 5,907,127 Q23K probably damaging Het
Dsc3 T A 18: 19,981,172 I342F probably damaging Het
Enpp3 A G 10: 24,795,716 L460P probably damaging Het
Epb41l2 A G 10: 25,504,192 E871G probably damaging Het
Exoc2 T C 13: 30,856,797 probably null Het
Fpr-rs7 A T 17: 20,113,626 S201T probably benign Het
Gtf2ird2 T C 5: 134,216,955 F685S probably damaging Het
Helz2 C T 2: 181,240,853 R49H possibly damaging Het
Ica1 A G 6: 8,667,375 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif21a A G 15: 90,997,541 probably null Het
Lamb3 T A 1: 193,330,908 C480* probably null Het
Lamc2 A G 1: 153,152,082 S199P probably damaging Het
Lrfn3 T C 7: 30,360,251 N183S probably benign Het
Lsm14a C A 7: 34,371,045 probably benign Het
Mest C A 6: 30,742,814 H146Q probably damaging Het
Mmp27 T C 9: 7,579,009 V339A probably damaging Het
Myo16 T C 8: 10,376,285 probably benign Het
Myoz1 C T 14: 20,653,611 probably benign Het
Nlrp5 A G 7: 23,417,708 M286V probably benign Het
Olfr1250 A C 2: 89,656,837 N201K possibly damaging Het
Olfr1386 A T 11: 49,470,331 Y60F probably damaging Het
Olfr1537 C T 9: 39,238,429 M1I probably null Het
Olfr273 C T 4: 52,855,566 V316I probably benign Het
Optc T C 1: 133,905,155 K69R probably benign Het
Osbpl3 A T 6: 50,346,377 M242K probably damaging Het
Pdzd9 T A 7: 120,668,401 S64C probably damaging Het
Pik3cg A G 12: 32,195,673 S859P possibly damaging Het
Ppp1r12a G T 10: 108,230,553 A202S possibly damaging Het
Rab32 A T 10: 10,550,867 F112I possibly damaging Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rtn3 A G 19: 7,467,880 probably benign Het
Sbk1 C T 7: 126,291,835 P147L probably damaging Het
Shpk T A 11: 73,204,031 M91K probably damaging Het
Slco6c1 C T 1: 97,128,101 S25N probably benign Het
Snx2 A T 18: 53,194,522 T107S probably benign Het
Tle2 G A 10: 81,586,314 V397I possibly damaging Het
Tmem131l T C 3: 83,898,417 D1573G probably damaging Het
Tnfrsf8 A G 4: 145,285,138 probably benign Het
Tpmt T C 13: 47,041,489 E36G probably benign Het
Trim30c T A 7: 104,383,481 T257S probably benign Het
Tsc2 A G 17: 24,596,958 L150P probably benign Het
Ttc26 A G 6: 38,425,114 probably null Het
Upf3a G C 8: 13,798,338 G378A possibly damaging Het
Yeats2 A T 16: 20,193,216 K514* probably null Het
Zfp11 A G 5: 129,657,525 Y291H probably benign Het
Zfp457 T C 13: 67,293,314 D399G possibly damaging Het
Other mutations in Col19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col19a1 APN 1 24561306 missense unknown
IGL00514:Col19a1 APN 1 24536932 missense unknown
IGL00756:Col19a1 APN 1 24322942 missense possibly damaging 0.85
IGL01408:Col19a1 APN 1 24306250 splice site probably benign
IGL01608:Col19a1 APN 1 24282545 missense probably damaging 1.00
IGL01664:Col19a1 APN 1 24561335 missense unknown
IGL01906:Col19a1 APN 1 24317429 missense probably damaging 1.00
IGL01916:Col19a1 APN 1 24534241 missense unknown
IGL02040:Col19a1 APN 1 24312045 critical splice donor site probably null
IGL02407:Col19a1 APN 1 24312372 splice site probably null
IGL02505:Col19a1 APN 1 24300584 splice site probably benign
IGL02606:Col19a1 APN 1 24534116 nonsense probably null
IGL02659:Col19a1 APN 1 24534034 missense unknown
IGL02815:Col19a1 APN 1 24285251 splice site probably null
IGL02880:Col19a1 APN 1 24325973 splice site probably benign
IGL02897:Col19a1 APN 1 24534098 missense unknown
IGL03102:Col19a1 APN 1 24328053 missense probably damaging 1.00
R0038:Col19a1 UTSW 1 24559744 missense unknown
R0109:Col19a1 UTSW 1 24559768 splice site probably null
R0124:Col19a1 UTSW 1 24526458 missense unknown
R0326:Col19a1 UTSW 1 24285051 critical splice donor site probably null
R0390:Col19a1 UTSW 1 24289655 splice site probably benign
R0675:Col19a1 UTSW 1 24575455 start gained probably benign
R0948:Col19a1 UTSW 1 24296801 missense probably damaging 0.98
R1014:Col19a1 UTSW 1 24301273 critical splice donor site probably null
R1619:Col19a1 UTSW 1 24534091 missense unknown
R1691:Col19a1 UTSW 1 24536941 missense unknown
R1878:Col19a1 UTSW 1 24317395 missense probably benign 0.40
R1901:Col19a1 UTSW 1 24536997 missense unknown
R1928:Col19a1 UTSW 1 24451754 splice site probably benign
R1940:Col19a1 UTSW 1 24264750 nonsense probably null
R2015:Col19a1 UTSW 1 24559753 missense unknown
R2571:Col19a1 UTSW 1 24374631 missense unknown
R2844:Col19a1 UTSW 1 24559681 missense unknown
R2845:Col19a1 UTSW 1 24559681 missense unknown
R3107:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R3861:Col19a1 UTSW 1 24326017 missense probably damaging 1.00
R3872:Col19a1 UTSW 1 24575327 splice site probably benign
R4180:Col19a1 UTSW 1 24270392 missense probably damaging 1.00
R4195:Col19a1 UTSW 1 24534052 missense unknown
R4196:Col19a1 UTSW 1 24534052 missense unknown
R4234:Col19a1 UTSW 1 24315395 splice site probably null
R4250:Col19a1 UTSW 1 24525645 missense unknown
R4396:Col19a1 UTSW 1 24510866 missense unknown
R4405:Col19a1 UTSW 1 24534109 missense unknown
R4450:Col19a1 UTSW 1 24322035 missense probably damaging 0.96
R4583:Col19a1 UTSW 1 24561329 missense unknown
R4980:Col19a1 UTSW 1 24526483 missense unknown
R5222:Col19a1 UTSW 1 24559640 splice site probably null
R5407:Col19a1 UTSW 1 24303494 missense probably damaging 0.99
R5439:Col19a1 UTSW 1 24293112 missense probably damaging 1.00
R5739:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5740:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5891:Col19a1 UTSW 1 24289725 missense probably damaging 1.00
R5996:Col19a1 UTSW 1 24328071 missense probably damaging 1.00
R6074:Col19a1 UTSW 1 24526483 missense unknown
R6152:Col19a1 UTSW 1 24374621 missense unknown
R6191:Col19a1 UTSW 1 24317393 missense probably damaging 1.00
R6236:Col19a1 UTSW 1 24279949 missense probably damaging 1.00
R6315:Col19a1 UTSW 1 24526452 missense unknown
R6709:Col19a1 UTSW 1 24282496 missense probably damaging 1.00
R6748:Col19a1 UTSW 1 24534070 missense unknown
R7098:Col19a1 UTSW 1 24526474 missense unknown
R7114:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R7292:Col19a1 UTSW 1 24530008 missense unknown
R7392:Col19a1 UTSW 1 24534034 missense unknown
R7478:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7480:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7481:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7512:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7618:Col19a1 UTSW 1 24322084 missense probably benign 0.07
R7698:Col19a1 UTSW 1 24312078 missense probably benign 0.09
R7711:Col19a1 UTSW 1 24530008 missense unknown
R7725:Col19a1 UTSW 1 24270444 missense possibly damaging 0.94
Z1088:Col19a1 UTSW 1 24279940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAATTGAGGCACTAGGCAGC -3'
(R):5'- ATGGGAGCTAACTGCAAGAACTGAC -3'

Sequencing Primer
(F):5'- GTTGAAGATCAGGCACTTTCC -3'
(R):5'- TCCAGAGCAAGACGACTTTG -3'
Posted On2013-10-16