Mutagenetix > Incidental Mutation

Incidental Mutation 'R0826:Atp1a1'

78215

Institutional Source

Beutler Lab

Gene Symbol

Atp1a1

Ensembl Gene

ENSMUSG00000033161

Gene Name

ATPase, Na+/K+ transporting, alpha 1 polypeptide

Synonyms

Atpa-1

MMRRC Submission

039006-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0826 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101576219-101604684 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101584853 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 569 (F569S)

Ref Sequence

ENSEMBL: ENSMUSP00000039657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036493]

AlphaFold

Q8VDN2

Predicted Effect

probably damaging
Transcript: ENSMUST00000036493
AA Change: F569S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: F569S

Domain	Start	End	E-Value	Type
low complexity region	21	28	N/A	INTRINSIC
Cation_ATPase_N	42	116	5e-20	SMART
Pfam:E1-E2_ATPase	134	365	1.6e-59	PFAM
Pfam:Hydrolase	370	729	2.7e-19	PFAM
Pfam:HAD	373	726	1.3e-18	PFAM
Pfam:Cation_ATPase	426	521	2.2e-25	PFAM
Pfam:Cation_ATPase_C	799	1008	1.2e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136340

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197360

Meta Mutation Damage Score

0.7433

Coding Region Coverage

1x: 99.5%
3x: 98.6%
10x: 95.7%
20x: 86.3%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
4930563D23Rik	G	A	16: 92,321,187	S71L	probably benign	Het
4931406C07Rik	T	C	9: 15,291,996		probably null	Het
Adamts16	T	A	13: 70,768,692	D727V	possibly damaging	Het
Anxa10	A	C	8: 62,076,284	L133*	probably null	Het
Arfgef3	G	A	10: 18,589,666	T2143I	probably damaging	Het
Arhgef17	T	C	7: 100,930,743	T333A	probably benign	Het
Arhgef40	A	G	14: 52,000,993	T1310A	probably benign	Het
Atg10	C	T	13: 90,936,586		probably null	Het
Baiap3	A	G	17: 25,245,229	W849R	possibly damaging	Het
Baz1a	A	T	12: 54,930,312	Y9*	probably null	Het
Catsperg2	C	T	7: 29,705,624	D702N	possibly damaging	Het
Clasrp	G	T	7: 19,584,301		probably benign	Het
Col11a1	G	A	3: 114,138,765	R113H	unknown	Het
Col19a1	T	C	1: 24,526,386	K288R	unknown	Het
Ctnnbl1	C	T	2: 157,799,417		probably benign	Het
Cttnbp2	A	G	6: 18,405,178		probably benign	Het
Dnah1	T	A	14: 31,303,907	I828F	probably benign	Het
Dpf2	G	T	19: 5,907,127	Q23K	probably damaging	Het
Dsc3	T	A	18: 19,981,172	I342F	probably damaging	Het
Enpp3	A	G	10: 24,795,716	L460P	probably damaging	Het
Epb41l2	A	G	10: 25,504,192	E871G	probably damaging	Het
Exoc2	T	C	13: 30,856,797		probably null	Het
Fpr-rs7	A	T	17: 20,113,626	S201T	probably benign	Het
Gtf2ird2	T	C	5: 134,216,955	F685S	probably damaging	Het
Helz2	C	T	2: 181,240,853	R49H	possibly damaging	Het
Ica1	A	G	6: 8,667,375		probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Kif21a	A	G	15: 90,997,541		probably null	Het
Lamb3	T	A	1: 193,330,908	C480*	probably null	Het
Lamc2	A	G	1: 153,152,082	S199P	probably damaging	Het
Lrfn3	T	C	7: 30,360,251	N183S	probably benign	Het
Lsm14a	C	A	7: 34,371,045		probably benign	Het
Mest	C	A	6: 30,742,814	H146Q	probably damaging	Het
Mmp27	T	C	9: 7,579,009	V339A	probably damaging	Het
Myo16	T	C	8: 10,376,285		probably benign	Het
Myoz1	C	T	14: 20,653,611		probably benign	Het
Nlrp5	A	G	7: 23,417,708	M286V	probably benign	Het
Olfr1250	A	C	2: 89,656,837	N201K	possibly damaging	Het
Olfr1386	A	T	11: 49,470,331	Y60F	probably damaging	Het
Olfr1537	C	T	9: 39,238,429	M1I	probably null	Het
Olfr273	C	T	4: 52,855,566	V316I	probably benign	Het
Optc	T	C	1: 133,905,155	K69R	probably benign	Het
Osbpl3	A	T	6: 50,346,377	M242K	probably damaging	Het
Pdzd9	T	A	7: 120,668,401	S64C	probably damaging	Het
Pik3cg	A	G	12: 32,195,673	S859P	possibly damaging	Het
Ppp1r12a	G	T	10: 108,230,553	A202S	possibly damaging	Het
Rab32	A	T	10: 10,550,867	F112I	possibly damaging	Het
Ror2	T	C	13: 53,113,217	Y394C	probably damaging	Het
Rtn3	A	G	19: 7,467,880		probably benign	Het
Sbk1	C	T	7: 126,291,835	P147L	probably damaging	Het
Shpk	T	A	11: 73,204,031	M91K	probably damaging	Het
Slco6c1	C	T	1: 97,128,101	S25N	probably benign	Het
Snx2	A	T	18: 53,194,522	T107S	probably benign	Het
Tle2	G	A	10: 81,586,314	V397I	possibly damaging	Het
Tmem131l	T	C	3: 83,898,417	D1573G	probably damaging	Het
Tnfrsf8	A	G	4: 145,285,138		probably benign	Het
Tpmt	T	C	13: 47,041,489	E36G	probably benign	Het
Trim30c	T	A	7: 104,383,481	T257S	probably benign	Het
Tsc2	A	G	17: 24,596,958	L150P	probably benign	Het
Ttc26	A	G	6: 38,425,114		probably null	Het
Upf3a	G	C	8: 13,798,338	G378A	possibly damaging	Het
Yeats2	A	T	16: 20,193,216	K514*	probably null	Het
Zfp11	A	G	5: 129,657,525	Y291H	probably benign	Het
Zfp457	T	C	13: 67,293,314	D399G	possibly damaging	Het

Other mutations in Atp1a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01396:Atp1a1	APN	3	101591453	missense	probably damaging	1.00
IGL01700:Atp1a1	APN	3	101594258	missense	possibly damaging	0.95
IGL01836:Atp1a1	APN	3	101591414	missense	probably damaging	1.00
IGL01863:Atp1a1	APN	3	101591889	nonsense	probably null
IGL02021:Atp1a1	APN	3	101594208	missense	probably benign	0.02
IGL02078:Atp1a1	APN	3	101591863	missense	probably damaging	1.00
IGL02873:Atp1a1	APN	3	101576578	missense	probably benign	0.16
IGL02934:Atp1a1	APN	3	101576992	nonsense	probably null
IGL03068:Atp1a1	APN	3	101583859	missense	probably benign	0.26
PIT4453001:Atp1a1	UTSW	3	101581179	missense	probably benign	0.01
R0009:Atp1a1	UTSW	3	101579835	missense	possibly damaging	0.67
R0506:Atp1a1	UTSW	3	101589812	missense	probably damaging	0.96
R0724:Atp1a1	UTSW	3	101592439	missense	possibly damaging	0.50
R1457:Atp1a1	UTSW	3	101590466	missense	probably damaging	1.00
R1732:Atp1a1	UTSW	3	101584799	missense	probably damaging	1.00
R1843:Atp1a1	UTSW	3	101582017	missense	probably benign	0.43
R2172:Atp1a1	UTSW	3	101590548	missense	probably benign
R3770:Atp1a1	UTSW	3	101581194	missense	probably benign	0.17
R3905:Atp1a1	UTSW	3	101590612	missense	probably benign	0.00
R4602:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4611:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4715:Atp1a1	UTSW	3	101591806	missense	possibly damaging	0.90
R4777:Atp1a1	UTSW	3	101594996	critical splice donor site	probably null
R4795:Atp1a1	UTSW	3	101583775	missense	probably benign	0.15
R5030:Atp1a1	UTSW	3	101579817	missense	probably benign	0.22
R5066:Atp1a1	UTSW	3	101582104	missense	probably damaging	0.98
R5165:Atp1a1	UTSW	3	101581789	missense	probably benign	0.01
R5297:Atp1a1	UTSW	3	101591127	missense	possibly damaging	0.82
R5307:Atp1a1	UTSW	3	101589964	missense	probably damaging	1.00
R5379:Atp1a1	UTSW	3	101582095	missense	probably benign	0.01
R5495:Atp1a1	UTSW	3	101591425	missense	probably benign	0.01
R5946:Atp1a1	UTSW	3	101589774	missense	probably benign	0.12
R6125:Atp1a1	UTSW	3	101590707	missense	probably damaging	1.00
R6789:Atp1a1	UTSW	3	101586298	missense	possibly damaging	0.71
R7339:Atp1a1	UTSW	3	101589872	missense	probably benign	0.44
R7552:Atp1a1	UTSW	3	101582121	nonsense	probably null
R7825:Atp1a1	UTSW	3	101586169	missense	probably benign	0.00
R8098:Atp1a1	UTSW	3	101582049	missense	probably damaging	0.97
R8175:Atp1a1	UTSW	3	101584854	missense	possibly damaging	0.79
R8281:Atp1a1	UTSW	3	101579624	missense	probably benign	0.12
R8403:Atp1a1	UTSW	3	101586904	missense	probably damaging	1.00
R8435:Atp1a1	UTSW	3	101582762	missense	probably benign
R8461:Atp1a1	UTSW	3	101589089	missense	probably benign	0.01
R8772:Atp1a1	UTSW	3	101579808	missense	probably benign
R8782:Atp1a1	UTSW	3	101594217	missense	possibly damaging	0.63
R8919:Atp1a1	UTSW	3	101591231	missense	probably damaging	1.00
R9066:Atp1a1	UTSW	3	101582022	missense	probably damaging	1.00
R9227:Atp1a1	UTSW	3	101592434	missense	probably damaging	1.00
X0019:Atp1a1	UTSW	3	101594213	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCAGCTCACAACACGGGGAATG -3'
(R):5'- TGGAGAAGTCTGTCTTCCAGCCAC -3'

Sequencing Primer
(F):5'- AAGTAAGGTGCTTCCTTGCC -3'
(R):5'- TGTCTTCCAGCCACTCTTG -3'

Posted On

2013-10-16