Incidental Mutation 'R0826:Ica1'
ID 78221
Institutional Source Beutler Lab
Gene Symbol Ica1
Ensembl Gene ENSMUSG00000062995
Gene Name islet cell autoantigen 1
Synonyms ICA69, 69kDa
MMRRC Submission 039006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock # R0826 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 8630527-8778488 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to G at 8667375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038403] [ENSMUST00000115518] [ENSMUST00000115519] [ENSMUST00000115520] [ENSMUST00000126430] [ENSMUST00000153390] [ENSMUST00000156695]
AlphaFold P97411
Predicted Effect probably benign
Transcript: ENSMUST00000038403
SMART Domains Protein: ENSMUSP00000040062
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 478 1.25e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115518
SMART Domains Protein: ENSMUSP00000111180
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115519
SMART Domains Protein: ENSMUSP00000111181
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 465 4.01e-83 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115520
SMART Domains Protein: ENSMUSP00000111182
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 478 1.25e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126430
SMART Domains Protein: ENSMUSP00000116861
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 1 83 3.3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127398
SMART Domains Protein: ENSMUSP00000118194
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Blast:Arfaptin 7 40 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153390
SMART Domains Protein: ENSMUSP00000117734
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156695
SMART Domains Protein: ENSMUSP00000138459
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Pfam:ICA69 260 301 4.1e-12 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an arfaptin homology domain that is found both in the cytosol and as membrane-bound form on the Golgi complex and immature secretory granules. This protein is believed to be an autoantigen in insulin-dependent diabetes mellitus and primary Sjogren's syndrome. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutation of this gene results in diabetes and spontaneous lethality at 4-5 months of age on a NOD background, however mice on a 129/Sv background are normal. Onset of diabetes starts 4 weeks later than wild-type NOD mice and mutants are resistant to cyclophospamide-accelerated diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930563D23Rik G A 16: 92,321,187 S71L probably benign Het
4931406C07Rik T C 9: 15,291,996 probably null Het
Adamts16 T A 13: 70,768,692 D727V possibly damaging Het
Anxa10 A C 8: 62,076,284 L133* probably null Het
Arfgef3 G A 10: 18,589,666 T2143I probably damaging Het
Arhgef17 T C 7: 100,930,743 T333A probably benign Het
Arhgef40 A G 14: 52,000,993 T1310A probably benign Het
Atg10 C T 13: 90,936,586 probably null Het
Atp1a1 A G 3: 101,584,853 F569S probably damaging Het
Baiap3 A G 17: 25,245,229 W849R possibly damaging Het
Baz1a A T 12: 54,930,312 Y9* probably null Het
Catsperg2 C T 7: 29,705,624 D702N possibly damaging Het
Clasrp G T 7: 19,584,301 probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Col19a1 T C 1: 24,526,386 K288R unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cttnbp2 A G 6: 18,405,178 probably benign Het
Dnah1 T A 14: 31,303,907 I828F probably benign Het
Dpf2 G T 19: 5,907,127 Q23K probably damaging Het
Dsc3 T A 18: 19,981,172 I342F probably damaging Het
Enpp3 A G 10: 24,795,716 L460P probably damaging Het
Epb41l2 A G 10: 25,504,192 E871G probably damaging Het
Exoc2 T C 13: 30,856,797 probably null Het
Fpr-rs7 A T 17: 20,113,626 S201T probably benign Het
Gtf2ird2 T C 5: 134,216,955 F685S probably damaging Het
Helz2 C T 2: 181,240,853 R49H possibly damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif21a A G 15: 90,997,541 probably null Het
Lamb3 T A 1: 193,330,908 C480* probably null Het
Lamc2 A G 1: 153,152,082 S199P probably damaging Het
Lrfn3 T C 7: 30,360,251 N183S probably benign Het
Lsm14a C A 7: 34,371,045 probably benign Het
Mest C A 6: 30,742,814 H146Q probably damaging Het
Mmp27 T C 9: 7,579,009 V339A probably damaging Het
Myo16 T C 8: 10,376,285 probably benign Het
Myoz1 C T 14: 20,653,611 probably benign Het
Nlrp5 A G 7: 23,417,708 M286V probably benign Het
Olfr1250 A C 2: 89,656,837 N201K possibly damaging Het
Olfr1386 A T 11: 49,470,331 Y60F probably damaging Het
Olfr1537 C T 9: 39,238,429 M1I probably null Het
Olfr273 C T 4: 52,855,566 V316I probably benign Het
Optc T C 1: 133,905,155 K69R probably benign Het
Osbpl3 A T 6: 50,346,377 M242K probably damaging Het
Pdzd9 T A 7: 120,668,401 S64C probably damaging Het
Pik3cg A G 12: 32,195,673 S859P possibly damaging Het
Ppp1r12a G T 10: 108,230,553 A202S possibly damaging Het
Rab32 A T 10: 10,550,867 F112I possibly damaging Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rtn3 A G 19: 7,467,880 probably benign Het
Sbk1 C T 7: 126,291,835 P147L probably damaging Het
Shpk T A 11: 73,204,031 M91K probably damaging Het
Slco6c1 C T 1: 97,128,101 S25N probably benign Het
Snx2 A T 18: 53,194,522 T107S probably benign Het
Tle2 G A 10: 81,586,314 V397I possibly damaging Het
Tmem131l T C 3: 83,898,417 D1573G probably damaging Het
Tnfrsf8 A G 4: 145,285,138 probably benign Het
Tpmt T C 13: 47,041,489 E36G probably benign Het
Trim30c T A 7: 104,383,481 T257S probably benign Het
Tsc2 A G 17: 24,596,958 L150P probably benign Het
Ttc26 A G 6: 38,425,114 probably null Het
Upf3a G C 8: 13,798,338 G378A possibly damaging Het
Yeats2 A T 16: 20,193,216 K514* probably null Het
Zfp11 A G 5: 129,657,525 Y291H probably benign Het
Zfp457 T C 13: 67,293,314 D399G possibly damaging Het
Other mutations in Ica1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ica1 APN 6 8653514 missense probably benign
IGL02248:Ica1 APN 6 8758387 utr 5 prime probably benign
IGL02547:Ica1 APN 6 8670691 splice site probably null
round_heels UTSW 6 8630799 critical splice acceptor site probably null
R0099:Ica1 UTSW 6 8749778 splice site probably benign
R0244:Ica1 UTSW 6 8653632 nonsense probably null
R0479:Ica1 UTSW 6 8754627 missense probably damaging 1.00
R0479:Ica1 UTSW 6 8754683 missense probably damaging 1.00
R0628:Ica1 UTSW 6 8644256 splice site probably benign
R1186:Ica1 UTSW 6 8672326 missense probably damaging 1.00
R1384:Ica1 UTSW 6 8742262 nonsense probably null
R1957:Ica1 UTSW 6 8749736 missense possibly damaging 0.85
R2431:Ica1 UTSW 6 8658265 missense probably benign
R3722:Ica1 UTSW 6 8659021 intron probably benign
R4224:Ica1 UTSW 6 8659960 missense probably benign 0.11
R4777:Ica1 UTSW 6 8644145 missense probably benign
R5633:Ica1 UTSW 6 8667257 missense possibly damaging 0.73
R5786:Ica1 UTSW 6 8672391 missense possibly damaging 0.50
R6033:Ica1 UTSW 6 8630799 critical splice acceptor site probably null
R6033:Ica1 UTSW 6 8630799 critical splice acceptor site probably null
R6053:Ica1 UTSW 6 8630783 missense probably benign 0.01
R6221:Ica1 UTSW 6 8644181 missense possibly damaging 0.82
R6794:Ica1 UTSW 6 8653659 missense probably benign 0.00
R6819:Ica1 UTSW 6 8742288 missense probably damaging 0.99
R7201:Ica1 UTSW 6 8644015 missense probably damaging 1.00
R7574:Ica1 UTSW 6 8658266 missense probably benign 0.00
R7841:Ica1 UTSW 6 8737072 missense probably damaging 1.00
R7920:Ica1 UTSW 6 8742274 missense probably benign 0.03
R8017:Ica1 UTSW 6 8658286 missense probably benign
R8511:Ica1 UTSW 6 8754726 missense probably benign 0.00
R9067:Ica1 UTSW 6 8667362 missense probably benign
R9133:Ica1 UTSW 6 8659921 missense probably benign 0.01
R9454:Ica1 UTSW 6 8667288 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCTCAACCAGTCTTCAGAAGTC -3'
(R):5'- CGTCCCTCACATGGCAGGAATTATC -3'

Sequencing Primer
(F):5'- ACCAGTCTTCAGAAGTCCATGTTG -3'
(R):5'- CATGGCAGGAATTATCACCTTCG -3'
Posted On 2013-10-16