Incidental Mutation 'R0826:Mest'
ID78223
Institutional Source Beutler Lab
Gene Symbol Mest
Ensembl Gene ENSMUSG00000051855
Gene Namemesoderm specific transcript
SynonymsPeg1
MMRRC Submission 039006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R0826 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location30723547-30748465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30742814 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 146 (H146Q)
Ref Sequence ENSEMBL: ENSMUSP00000129639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048774] [ENSMUST00000115127] [ENSMUST00000124665] [ENSMUST00000147400] [ENSMUST00000151777] [ENSMUST00000157040] [ENSMUST00000163949]
Predicted Effect probably benign
Transcript: ENSMUST00000048774
SMART Domains Protein: ENSMUSP00000038368
Gene: ENSMUSG00000025607

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 2.6e-134 PFAM
Pfam:COP-gamma_platf 609 756 7.7e-66 PFAM
Pfam:Coatomer_g_Cpla 758 870 1.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083567
Predicted Effect probably benign
Transcript: ENSMUST00000115127
SMART Domains Protein: ENSMUSP00000110780
Gene: ENSMUSG00000051855

DomainStartEndE-ValueType
SCOP:d1qo7a_ 23 107 3e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124665
AA Change: H153Q

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117713
Gene: ENSMUSG00000051855
AA Change: H153Q

DomainStartEndE-ValueType
Pfam:DUF1057 50 183 3.9e-9 PFAM
Pfam:Abhydrolase_6 79 198 7.8e-21 PFAM
Pfam:Abhydrolase_1 104 191 4.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137521
Predicted Effect probably damaging
Transcript: ENSMUST00000147400
AA Change: H138Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120408
Gene: ENSMUSG00000051855
AA Change: H138Q

DomainStartEndE-ValueType
Pfam:DUF1057 35 144 3.3e-9 PFAM
Pfam:Abhydrolase_6 64 145 3.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149496
Predicted Effect probably benign
Transcript: ENSMUST00000151777
SMART Domains Protein: ENSMUSP00000115541
Gene: ENSMUSG00000051855

DomainStartEndE-ValueType
SCOP:d1qo7a_ 42 133 1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157040
AA Change: H137Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119038
Gene: ENSMUSG00000051855
AA Change: H137Q

DomainStartEndE-ValueType
Pfam:DUF1057 34 167 3.1e-9 PFAM
Pfam:Abhydrolase_6 63 182 6.2e-21 PFAM
Pfam:Abhydrolase_1 88 176 4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163949
AA Change: H146Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129639
Gene: ENSMUSG00000051855
AA Change: H146Q

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:DUF1057 43 176 7.1e-9 PFAM
Pfam:Abhydrolase_1 70 321 2.5e-16 PFAM
Pfam:Abhydrolase_5 71 315 5.9e-9 PFAM
Pfam:Abhydrolase_6 72 327 7.1e-13 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha/beta hydrolase superfamily. It is imprinted, exhibiting preferential expression from the paternal allele in fetal tissues, and isoform-specific imprinting in lymphocytes. The loss of imprinting of this gene has been linked to certain types of cancer and may be due to promotor switching. The encoded protein may play a role in development. Alternatively spliced transcript variants encoding multiple isoforms have been identified for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3 and 4, and the long arm of chromosomes 6 and 15. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit retardation of embryonic growth and subtle cardiac abnormalities associated with reduced postnatal survival rates. Mutant females exhibit abnormal maternal behavior and impaired placentophagia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930563D23Rik G A 16: 92,321,187 S71L probably benign Het
4931406C07Rik T C 9: 15,291,996 probably null Het
Adamts16 T A 13: 70,768,692 D727V possibly damaging Het
Anxa10 A C 8: 62,076,284 L133* probably null Het
Arfgef3 G A 10: 18,589,666 T2143I probably damaging Het
Arhgef17 T C 7: 100,930,743 T333A probably benign Het
Arhgef40 A G 14: 52,000,993 T1310A probably benign Het
Atg10 C T 13: 90,936,586 probably null Het
Atp1a1 A G 3: 101,584,853 F569S probably damaging Het
Baiap3 A G 17: 25,245,229 W849R possibly damaging Het
Baz1a A T 12: 54,930,312 Y9* probably null Het
Catsperg2 C T 7: 29,705,624 D702N possibly damaging Het
Clasrp G T 7: 19,584,301 probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Col19a1 T C 1: 24,526,386 K288R unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cttnbp2 A G 6: 18,405,178 probably benign Het
Dnah1 T A 14: 31,303,907 I828F probably benign Het
Dpf2 G T 19: 5,907,127 Q23K probably damaging Het
Dsc3 T A 18: 19,981,172 I342F probably damaging Het
Enpp3 A G 10: 24,795,716 L460P probably damaging Het
Epb41l2 A G 10: 25,504,192 E871G probably damaging Het
Exoc2 T C 13: 30,856,797 probably null Het
Fpr-rs7 A T 17: 20,113,626 S201T probably benign Het
Gtf2ird2 T C 5: 134,216,955 F685S probably damaging Het
Helz2 C T 2: 181,240,853 R49H possibly damaging Het
Ica1 A G 6: 8,667,375 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif21a A G 15: 90,997,541 probably null Het
Lamb3 T A 1: 193,330,908 C480* probably null Het
Lamc2 A G 1: 153,152,082 S199P probably damaging Het
Lrfn3 T C 7: 30,360,251 N183S probably benign Het
Lsm14a C A 7: 34,371,045 probably benign Het
Mmp27 T C 9: 7,579,009 V339A probably damaging Het
Myo16 T C 8: 10,376,285 probably benign Het
Myoz1 C T 14: 20,653,611 probably benign Het
Nlrp5 A G 7: 23,417,708 M286V probably benign Het
Olfr1250 A C 2: 89,656,837 N201K possibly damaging Het
Olfr1386 A T 11: 49,470,331 Y60F probably damaging Het
Olfr1537 C T 9: 39,238,429 M1I probably null Het
Olfr273 C T 4: 52,855,566 V316I probably benign Het
Optc T C 1: 133,905,155 K69R probably benign Het
Osbpl3 A T 6: 50,346,377 M242K probably damaging Het
Pdzd9 T A 7: 120,668,401 S64C probably damaging Het
Pik3cg A G 12: 32,195,673 S859P possibly damaging Het
Ppp1r12a G T 10: 108,230,553 A202S possibly damaging Het
Rab32 A T 10: 10,550,867 F112I possibly damaging Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rtn3 A G 19: 7,467,880 probably benign Het
Sbk1 C T 7: 126,291,835 P147L probably damaging Het
Shpk T A 11: 73,204,031 M91K probably damaging Het
Slco6c1 C T 1: 97,128,101 S25N probably benign Het
Snx2 A T 18: 53,194,522 T107S probably benign Het
Tle2 G A 10: 81,586,314 V397I possibly damaging Het
Tmem131l T C 3: 83,898,417 D1573G probably damaging Het
Tnfrsf8 A G 4: 145,285,138 probably benign Het
Tpmt T C 13: 47,041,489 E36G probably benign Het
Trim30c T A 7: 104,383,481 T257S probably benign Het
Tsc2 A G 17: 24,596,958 L150P probably benign Het
Ttc26 A G 6: 38,425,114 probably null Het
Upf3a G C 8: 13,798,338 G378A possibly damaging Het
Yeats2 A T 16: 20,193,216 K514* probably null Het
Zfp11 A G 5: 129,657,525 Y291H probably benign Het
Zfp457 T C 13: 67,293,314 D399G possibly damaging Het
Other mutations in Mest
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Mest APN 6 30746331 unclassified probably benign
IGL02231:Mest APN 6 30740773 missense possibly damaging 0.93
IGL02386:Mest APN 6 30744914 missense possibly damaging 0.65
R0102:Mest UTSW 6 30746270 missense probably damaging 1.00
R0102:Mest UTSW 6 30746270 missense probably damaging 1.00
R0972:Mest UTSW 6 30740684 nonsense probably null
R1580:Mest UTSW 6 30745823 unclassified probably benign
R1768:Mest UTSW 6 30745139 missense probably benign 0.01
R1835:Mest UTSW 6 30742791 missense probably benign 0.14
R2131:Mest UTSW 6 30745885 missense probably damaging 1.00
R3918:Mest UTSW 6 30742750 missense probably benign 0.07
R3919:Mest UTSW 6 30742750 missense probably benign 0.07
R4544:Mest UTSW 6 30740680 missense probably damaging 1.00
R4546:Mest UTSW 6 30740680 missense probably damaging 1.00
R4647:Mest UTSW 6 30745110 nonsense probably null
R6818:Mest UTSW 6 30746287 missense probably damaging 1.00
R7048:Mest UTSW 6 30742724 missense probably damaging 1.00
R7158:Mest UTSW 6 30744914 missense possibly damaging 0.65
R7290:Mest UTSW 6 30747159 missense unknown
R7734:Mest UTSW 6 30746300 missense unknown
Z1177:Mest UTSW 6 30723575 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TACAAATGAGGGTCTGGCAGGCAC -3'
(R):5'- GAGGGATCAATCTTCTCCCACAACG -3'

Sequencing Primer
(F):5'- TGGCAGGCACTGCTAACATC -3'
(R):5'- ACAGAGACTCTTTATGGTGAGCC -3'
Posted On2013-10-16