Incidental Mutation 'R0826:Ttc26'
ID78224
Institutional Source Beutler Lab
Gene Symbol Ttc26
Ensembl Gene ENSMUSG00000056832
Gene Nametetratricopeptide repeat domain 26
Synonyms
MMRRC Submission 039006-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock #R0826 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location38381469-38427647 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 38425114 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159145] [ENSMUST00000162554]
Predicted Effect probably benign
Transcript: ENSMUST00000159145
SMART Domains Protein: ENSMUSP00000124873
Gene: ENSMUSG00000056832

DomainStartEndE-ValueType
low complexity region 19 29 N/A INTRINSIC
Pfam:TPR_2 58 88 1.2e-5 PFAM
Pfam:TPR_8 58 91 1.7e-3 PFAM
Pfam:TPR_1 61 87 4.6e-4 PFAM
Pfam:TPR_11 63 113 4.9e-11 PFAM
Pfam:TPR_19 67 113 3.1e-7 PFAM
Pfam:TPR_8 89 113 2e-3 PFAM
Pfam:TPR_1 91 113 1.7e-4 PFAM
Pfam:TPR_2 91 113 2.4e-3 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162554
SMART Domains Protein: ENSMUSP00000124369
Gene: ENSMUSG00000056832

DomainStartEndE-ValueType
low complexity region 19 29 N/A INTRINSIC
Pfam:TPR_2 58 88 2.7e-5 PFAM
Pfam:TPR_11 63 117 9e-9 PFAM
Pfam:TPR_9 157 227 9.2e-4 PFAM
Blast:TPR 359 392 9e-10 BLAST
Blast:TPR 461 494 8e-15 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous nonsense mutation exhibit partial prenatal lethality, a hopping gait, preaxial polydactyly, male sterility due to lack of sperm flagella, impaired hearing, and patterning defects that are typical of impaired Hedgehog signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930563D23Rik G A 16: 92,321,187 S71L probably benign Het
4931406C07Rik T C 9: 15,291,996 probably null Het
Adamts16 T A 13: 70,768,692 D727V possibly damaging Het
Anxa10 A C 8: 62,076,284 L133* probably null Het
Arfgef3 G A 10: 18,589,666 T2143I probably damaging Het
Arhgef17 T C 7: 100,930,743 T333A probably benign Het
Arhgef40 A G 14: 52,000,993 T1310A probably benign Het
Atg10 C T 13: 90,936,586 probably null Het
Atp1a1 A G 3: 101,584,853 F569S probably damaging Het
Baiap3 A G 17: 25,245,229 W849R possibly damaging Het
Baz1a A T 12: 54,930,312 Y9* probably null Het
Catsperg2 C T 7: 29,705,624 D702N possibly damaging Het
Clasrp G T 7: 19,584,301 probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Col19a1 T C 1: 24,526,386 K288R unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cttnbp2 A G 6: 18,405,178 probably benign Het
Dnah1 T A 14: 31,303,907 I828F probably benign Het
Dpf2 G T 19: 5,907,127 Q23K probably damaging Het
Dsc3 T A 18: 19,981,172 I342F probably damaging Het
Enpp3 A G 10: 24,795,716 L460P probably damaging Het
Epb41l2 A G 10: 25,504,192 E871G probably damaging Het
Exoc2 T C 13: 30,856,797 probably null Het
Fpr-rs7 A T 17: 20,113,626 S201T probably benign Het
Gtf2ird2 T C 5: 134,216,955 F685S probably damaging Het
Helz2 C T 2: 181,240,853 R49H possibly damaging Het
Ica1 A G 6: 8,667,375 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif21a A G 15: 90,997,541 probably null Het
Lamb3 T A 1: 193,330,908 C480* probably null Het
Lamc2 A G 1: 153,152,082 S199P probably damaging Het
Lrfn3 T C 7: 30,360,251 N183S probably benign Het
Lsm14a C A 7: 34,371,045 probably benign Het
Mest C A 6: 30,742,814 H146Q probably damaging Het
Mmp27 T C 9: 7,579,009 V339A probably damaging Het
Myo16 T C 8: 10,376,285 probably benign Het
Myoz1 C T 14: 20,653,611 probably benign Het
Nlrp5 A G 7: 23,417,708 M286V probably benign Het
Olfr1250 A C 2: 89,656,837 N201K possibly damaging Het
Olfr1386 A T 11: 49,470,331 Y60F probably damaging Het
Olfr1537 C T 9: 39,238,429 M1I probably null Het
Olfr273 C T 4: 52,855,566 V316I probably benign Het
Optc T C 1: 133,905,155 K69R probably benign Het
Osbpl3 A T 6: 50,346,377 M242K probably damaging Het
Pdzd9 T A 7: 120,668,401 S64C probably damaging Het
Pik3cg A G 12: 32,195,673 S859P possibly damaging Het
Ppp1r12a G T 10: 108,230,553 A202S possibly damaging Het
Rab32 A T 10: 10,550,867 F112I possibly damaging Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rtn3 A G 19: 7,467,880 probably benign Het
Sbk1 C T 7: 126,291,835 P147L probably damaging Het
Shpk T A 11: 73,204,031 M91K probably damaging Het
Slco6c1 C T 1: 97,128,101 S25N probably benign Het
Snx2 A T 18: 53,194,522 T107S probably benign Het
Tle2 G A 10: 81,586,314 V397I possibly damaging Het
Tmem131l T C 3: 83,898,417 D1573G probably damaging Het
Tnfrsf8 A G 4: 145,285,138 probably benign Het
Tpmt T C 13: 47,041,489 E36G probably benign Het
Trim30c T A 7: 104,383,481 T257S probably benign Het
Tsc2 A G 17: 24,596,958 L150P probably benign Het
Upf3a G C 8: 13,798,338 G378A possibly damaging Het
Yeats2 A T 16: 20,193,216 K514* probably null Het
Zfp11 A G 5: 129,657,525 Y291H probably benign Het
Zfp457 T C 13: 67,293,314 D399G possibly damaging Het
Other mutations in Ttc26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Ttc26 APN 6 38382220 splice site probably benign
IGL02049:Ttc26 APN 6 38425132 missense probably benign 0.16
IGL02403:Ttc26 APN 6 38409438 missense possibly damaging 0.95
IGL02902:Ttc26 APN 6 38425162 missense probably benign 0.21
IGL03189:Ttc26 APN 6 38425231 missense probably benign 0.00
IGL03410:Ttc26 APN 6 38385500 missense probably damaging 1.00
R0346:Ttc26 UTSW 6 38409435 missense probably damaging 1.00
R0562:Ttc26 UTSW 6 38401129 missense probably damaging 1.00
R1212:Ttc26 UTSW 6 38410793 missense probably damaging 1.00
R1778:Ttc26 UTSW 6 38409476 missense possibly damaging 0.93
R1972:Ttc26 UTSW 6 38410803 missense probably benign 0.20
R2903:Ttc26 UTSW 6 38401102 missense possibly damaging 0.61
R2904:Ttc26 UTSW 6 38401102 missense possibly damaging 0.61
R2905:Ttc26 UTSW 6 38401102 missense possibly damaging 0.61
R3788:Ttc26 UTSW 6 38403524 critical splice donor site probably null
R4222:Ttc26 UTSW 6 38395075 missense probably damaging 1.00
R4392:Ttc26 UTSW 6 38381557 start gained probably benign
R4930:Ttc26 UTSW 6 38391540 missense probably damaging 1.00
R5484:Ttc26 UTSW 6 38389122 missense probably benign 0.10
R5920:Ttc26 UTSW 6 38412070 missense probably damaging 1.00
R6229:Ttc26 UTSW 6 38395040 missense probably benign 0.22
R6429:Ttc26 UTSW 6 38398313 missense possibly damaging 0.69
R6901:Ttc26 UTSW 6 38401144 missense possibly damaging 0.80
R7448:Ttc26 UTSW 6 38404487 nonsense probably null
R7554:Ttc26 UTSW 6 38385500 missense probably null 1.00
R7650:Ttc26 UTSW 6 38395040 missense probably benign 0.22
X0066:Ttc26 UTSW 6 38405942 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGCAAATGCTGGGCATTCACC -3'
(R):5'- TCCAATTTGACGTGAGAGGAAGCTG -3'

Sequencing Primer
(F):5'- GGGCATTCACCAAATTCTGG -3'
(R):5'- TGAGAGGAAGCTGGTCCTG -3'
Posted On2013-10-16