Incidental Mutation 'R0826:Upf3a'
ID78236
Institutional Source Beutler Lab
Gene Symbol Upf3a
Ensembl Gene ENSMUSG00000038398
Gene NameUPF3 regulator of nonsense transcripts homolog A (yeast)
Synonyms2600001C03Rik, RENT3A, 4930546M19Rik, UPF3
MMRRC Submission 039006-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0826 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13785615-13799193 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 13798338 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 378 (G378A)
Ref Sequence ENSEMBL: ENSMUSP00000037354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043767]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043767
AA Change: G378A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037354
Gene: ENSMUSG00000038398
AA Change: G378A

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:Smg4_UPF3 63 224 1.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211724
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The encoded protein is one of two functional homologs to yeast Upf3p. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. It forms with Y14 a complex that binds specifically 20 nt upstream of exon-exon junctions. This gene is located on the long arm of chromosome 13. Two splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: The gene product protects against mRNA transcript degradation. Homozygous constitutive KO is embryonic lethal. Homozygous conditional KO in testes leads to reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930563D23Rik G A 16: 92,321,187 S71L probably benign Het
4931406C07Rik T C 9: 15,291,996 probably null Het
Adamts16 T A 13: 70,768,692 D727V possibly damaging Het
Anxa10 A C 8: 62,076,284 L133* probably null Het
Arfgef3 G A 10: 18,589,666 T2143I probably damaging Het
Arhgef17 T C 7: 100,930,743 T333A probably benign Het
Arhgef40 A G 14: 52,000,993 T1310A probably benign Het
Atg10 C T 13: 90,936,586 probably null Het
Atp1a1 A G 3: 101,584,853 F569S probably damaging Het
Baiap3 A G 17: 25,245,229 W849R possibly damaging Het
Baz1a A T 12: 54,930,312 Y9* probably null Het
Catsperg2 C T 7: 29,705,624 D702N possibly damaging Het
Clasrp G T 7: 19,584,301 probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Col19a1 T C 1: 24,526,386 K288R unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cttnbp2 A G 6: 18,405,178 probably benign Het
Dnah1 T A 14: 31,303,907 I828F probably benign Het
Dpf2 G T 19: 5,907,127 Q23K probably damaging Het
Dsc3 T A 18: 19,981,172 I342F probably damaging Het
Enpp3 A G 10: 24,795,716 L460P probably damaging Het
Epb41l2 A G 10: 25,504,192 E871G probably damaging Het
Exoc2 T C 13: 30,856,797 probably null Het
Fpr-rs7 A T 17: 20,113,626 S201T probably benign Het
Gtf2ird2 T C 5: 134,216,955 F685S probably damaging Het
Helz2 C T 2: 181,240,853 R49H possibly damaging Het
Ica1 A G 6: 8,667,375 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif21a A G 15: 90,997,541 probably null Het
Lamb3 T A 1: 193,330,908 C480* probably null Het
Lamc2 A G 1: 153,152,082 S199P probably damaging Het
Lrfn3 T C 7: 30,360,251 N183S probably benign Het
Lsm14a C A 7: 34,371,045 probably benign Het
Mest C A 6: 30,742,814 H146Q probably damaging Het
Mmp27 T C 9: 7,579,009 V339A probably damaging Het
Myo16 T C 8: 10,376,285 probably benign Het
Myoz1 C T 14: 20,653,611 probably benign Het
Nlrp5 A G 7: 23,417,708 M286V probably benign Het
Olfr1250 A C 2: 89,656,837 N201K possibly damaging Het
Olfr1386 A T 11: 49,470,331 Y60F probably damaging Het
Olfr1537 C T 9: 39,238,429 M1I probably null Het
Olfr273 C T 4: 52,855,566 V316I probably benign Het
Optc T C 1: 133,905,155 K69R probably benign Het
Osbpl3 A T 6: 50,346,377 M242K probably damaging Het
Pdzd9 T A 7: 120,668,401 S64C probably damaging Het
Pik3cg A G 12: 32,195,673 S859P possibly damaging Het
Ppp1r12a G T 10: 108,230,553 A202S possibly damaging Het
Rab32 A T 10: 10,550,867 F112I possibly damaging Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rtn3 A G 19: 7,467,880 probably benign Het
Sbk1 C T 7: 126,291,835 P147L probably damaging Het
Shpk T A 11: 73,204,031 M91K probably damaging Het
Slco6c1 C T 1: 97,128,101 S25N probably benign Het
Snx2 A T 18: 53,194,522 T107S probably benign Het
Tle2 G A 10: 81,586,314 V397I possibly damaging Het
Tmem131l T C 3: 83,898,417 D1573G probably damaging Het
Tnfrsf8 A G 4: 145,285,138 probably benign Het
Tpmt T C 13: 47,041,489 E36G probably benign Het
Trim30c T A 7: 104,383,481 T257S probably benign Het
Tsc2 A G 17: 24,596,958 L150P probably benign Het
Ttc26 A G 6: 38,425,114 probably null Het
Yeats2 A T 16: 20,193,216 K514* probably null Het
Zfp11 A G 5: 129,657,525 Y291H probably benign Het
Zfp457 T C 13: 67,293,314 D399G possibly damaging Het
Other mutations in Upf3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Upf3a APN 8 13786221 missense probably damaging 0.98
IGL01678:Upf3a APN 8 13791930 missense probably benign 0.21
IGL02072:Upf3a APN 8 13798368 missense probably damaging 0.99
R0309:Upf3a UTSW 8 13795500 splice site probably null
R0564:Upf3a UTSW 8 13795656 missense probably benign 0.42
R0571:Upf3a UTSW 8 13792184 missense probably damaging 0.98
R1387:Upf3a UTSW 8 13792118 missense probably damaging 1.00
R1913:Upf3a UTSW 8 13792108 missense probably damaging 1.00
R2072:Upf3a UTSW 8 13785850 missense possibly damaging 0.63
R2520:Upf3a UTSW 8 13796443 intron probably null
R3845:Upf3a UTSW 8 13798238 missense probably benign 0.16
R4239:Upf3a UTSW 8 13796591 missense probably benign 0.28
R4424:Upf3a UTSW 8 13796573 missense probably benign 0.09
R5522:Upf3a UTSW 8 13795497 critical splice donor site probably null
R6321:Upf3a UTSW 8 13787466 missense possibly damaging 0.53
R6922:Upf3a UTSW 8 13791911 missense probably damaging 1.00
R7583:Upf3a UTSW 8 13785889 splice site probably null
R7585:Upf3a UTSW 8 13787418 missense probably damaging 1.00
R7695:Upf3a UTSW 8 13798279 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACTCACAGGCTACAGGATACCAG -3'
(R):5'- TGAAATTCAGCCCACATGGGAAGAC -3'

Sequencing Primer
(F):5'- CTACAGGATACCAGTGATAAAGAGCC -3'
(R):5'- CACAAGGCAGATTGTTCTTATCTAGC -3'
Posted On2013-10-16