Mutagenetix > Incidental Mutations

Incidental Mutation 'R0826:Enpp3'

78243

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

039006-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R0826 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24795716 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 460 (L460P)

Ref Sequence

ENSEMBL: ENSMUSP00000020169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020169
AA Change: L460P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: L460P

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000218343
AA Change: L37P

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218619

Meta Mutation Damage Score

0.6226

Coding Region Coverage

1x: 99.5%
3x: 98.6%
10x: 95.7%
20x: 86.3%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
4930563D23Rik	G	A	16: 92,321,187	S71L	probably benign	Het
4931406C07Rik	T	C	9: 15,291,996		probably null	Het
Adamts16	T	A	13: 70,768,692	D727V	possibly damaging	Het
Anxa10	A	C	8: 62,076,284	L133*	probably null	Het
Arfgef3	G	A	10: 18,589,666	T2143I	probably damaging	Het
Arhgef17	T	C	7: 100,930,743	T333A	probably benign	Het
Arhgef40	A	G	14: 52,000,993	T1310A	probably benign	Het
Atg10	C	T	13: 90,936,586		probably null	Het
Atp1a1	A	G	3: 101,584,853	F569S	probably damaging	Het
Baiap3	A	G	17: 25,245,229	W849R	possibly damaging	Het
Baz1a	A	T	12: 54,930,312	Y9*	probably null	Het
Catsperg2	C	T	7: 29,705,624	D702N	possibly damaging	Het
Clasrp	G	T	7: 19,584,301		probably benign	Het
Col11a1	G	A	3: 114,138,765	R113H	unknown	Het
Col19a1	T	C	1: 24,526,386	K288R	unknown	Het
Ctnnbl1	C	T	2: 157,799,417		probably benign	Het
Cttnbp2	A	G	6: 18,405,178		probably benign	Het
Dnah1	T	A	14: 31,303,907	I828F	probably benign	Het
Dpf2	G	T	19: 5,907,127	Q23K	probably damaging	Het
Dsc3	T	A	18: 19,981,172	I342F	probably damaging	Het
Epb41l2	A	G	10: 25,504,192	E871G	probably damaging	Het
Exoc2	T	C	13: 30,856,797		probably null	Het
Fpr-rs7	A	T	17: 20,113,626	S201T	probably benign	Het
Gtf2ird2	T	C	5: 134,216,955	F685S	probably damaging	Het
Helz2	C	T	2: 181,240,853	R49H	possibly damaging	Het
Ica1	A	G	6: 8,667,375		probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Kif21a	A	G	15: 90,997,541		probably null	Het
Lamb3	T	A	1: 193,330,908	C480*	probably null	Het
Lamc2	A	G	1: 153,152,082	S199P	probably damaging	Het
Lrfn3	T	C	7: 30,360,251	N183S	probably benign	Het
Lsm14a	C	A	7: 34,371,045		probably benign	Het
Mest	C	A	6: 30,742,814	H146Q	probably damaging	Het
Mmp27	T	C	9: 7,579,009	V339A	probably damaging	Het
Myo16	T	C	8: 10,376,285		probably benign	Het
Myoz1	C	T	14: 20,653,611		probably benign	Het
Nlrp5	A	G	7: 23,417,708	M286V	probably benign	Het
Olfr1250	A	C	2: 89,656,837	N201K	possibly damaging	Het
Olfr1386	A	T	11: 49,470,331	Y60F	probably damaging	Het
Olfr1537	C	T	9: 39,238,429	M1I	probably null	Het
Olfr273	C	T	4: 52,855,566	V316I	probably benign	Het
Optc	T	C	1: 133,905,155	K69R	probably benign	Het
Osbpl3	A	T	6: 50,346,377	M242K	probably damaging	Het
Pdzd9	T	A	7: 120,668,401	S64C	probably damaging	Het
Pik3cg	A	G	12: 32,195,673	S859P	possibly damaging	Het
Ppp1r12a	G	T	10: 108,230,553	A202S	possibly damaging	Het
Rab32	A	T	10: 10,550,867	F112I	possibly damaging	Het
Ror2	T	C	13: 53,113,217	Y394C	probably damaging	Het
Rtn3	A	G	19: 7,467,880		probably benign	Het
Sbk1	C	T	7: 126,291,835	P147L	probably damaging	Het
Shpk	T	A	11: 73,204,031	M91K	probably damaging	Het
Slco6c1	C	T	1: 97,128,101	S25N	probably benign	Het
Snx2	A	T	18: 53,194,522	T107S	probably benign	Het
Tle2	G	A	10: 81,586,314	V397I	possibly damaging	Het
Tmem131l	T	C	3: 83,898,417	D1573G	probably damaging	Het
Tnfrsf8	A	G	4: 145,285,138		probably benign	Het
Tpmt	T	C	13: 47,041,489	E36G	probably benign	Het
Trim30c	T	A	7: 104,383,481	T257S	probably benign	Het
Tsc2	A	G	17: 24,596,958	L150P	probably benign	Het
Ttc26	A	G	6: 38,425,114		probably null	Het
Upf3a	G	C	8: 13,798,338	G378A	possibly damaging	Het
Yeats2	A	T	16: 20,193,216	K514*	probably null	Het
Zfp11	A	G	5: 129,657,525	Y291H	probably benign	Het
Zfp457	T	C	13: 67,293,314	D399G	possibly damaging	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTGCTCCCCAAAAGTCGCTTTA -3'
(R):5'- GCAGTCTGCGTATTTGATGTGCC -3'

Sequencing Primer
(F):5'- ggttctcccctgcctctg -3'
(R):5'- GCCGTGGGAGAAATGCTTG -3'

Posted On

2013-10-16