Incidental Mutation 'R0826:Tle2'
ID78245
Institutional Source Beutler Lab
Gene Symbol Tle2
Ensembl Gene ENSMUSG00000034771
Gene Nametransducin-like enhancer of split 2
SynonymsGrg2
MMRRC Submission 039006-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R0826 (G1)
Quality Score212
Status Validated
Chromosome10
Chromosomal Location81574561-81590845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81586314 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 397 (V397I)
Ref Sequence ENSEMBL: ENSMUSP00000121125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072020] [ENSMUST00000135211] [ENSMUST00000142948] [ENSMUST00000146358] [ENSMUST00000146916]
Predicted Effect probably benign
Transcript: ENSMUST00000072020
SMART Domains Protein: ENSMUSP00000071905
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
WD40 283 320 9.6e-2 SMART
Blast:WD40 334 372 2e-12 BLAST
WD40 377 415 6.16e0 SMART
WD40 418 455 7.43e-1 SMART
Blast:WD40 460 496 4e-13 BLAST
WD40 499 538 1.43e0 SMART
WD40 541 578 2.97e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124854
SMART Domains Protein: ENSMUSP00000118334
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Blast:WD40 6 44 9e-20 BLAST
WD40 46 85 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129798
Predicted Effect probably benign
Transcript: ENSMUST00000131411
SMART Domains Protein: ENSMUSP00000114400
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
WD40 36 75 1.2e-2 SMART
WD40 76 116 2.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135211
AA Change: V363I

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117453
Gene: ENSMUSG00000034771
AA Change: V363I

DomainStartEndE-ValueType
Pfam:TLE_N 1 122 3e-68 PFAM
low complexity region 133 160 N/A INTRINSIC
low complexity region 172 194 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
WD40 436 473 5.6e-3 SMART
WD40 479 520 9.6e-2 SMART
WD40 525 564 1.88e-4 SMART
WD40 567 606 3.72e-8 SMART
Blast:WD40 609 647 8e-18 BLAST
WD40 649 688 1.2e-2 SMART
WD40 689 729 2.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141913
Predicted Effect probably benign
Transcript: ENSMUST00000142948
SMART Domains Protein: ENSMUSP00000117287
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
WD40 273 310 9.6e-2 SMART
Blast:WD40 324 362 2e-12 BLAST
WD40 367 405 6.16e0 SMART
WD40 408 445 7.43e-1 SMART
Blast:WD40 450 486 4e-13 BLAST
WD40 489 528 1.43e0 SMART
WD40 531 568 2.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146239
Predicted Effect possibly damaging
Transcript: ENSMUST00000146358
AA Change: V397I

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121125
Gene: ENSMUSG00000034771
AA Change: V397I

DomainStartEndE-ValueType
Pfam:TLE_N 1 64 2e-31 PFAM
Pfam:TLE_N 81 154 4.3e-34 PFAM
low complexity region 167 194 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
low complexity region 296 311 N/A INTRINSIC
low complexity region 366 386 N/A INTRINSIC
WD40 471 508 5.6e-3 SMART
WD40 514 555 9.6e-2 SMART
WD40 560 599 1.88e-4 SMART
WD40 602 641 3.72e-8 SMART
Blast:WD40 644 682 9e-18 BLAST
WD40 684 723 1.2e-2 SMART
WD40 724 764 2.07e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146916
AA Change: V374I

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121173
Gene: ENSMUSG00000034771
AA Change: V374I

DomainStartEndE-ValueType
Pfam:TLE_N 1 134 1.6e-75 PFAM
low complexity region 144 171 N/A INTRINSIC
low complexity region 183 205 N/A INTRINSIC
low complexity region 273 288 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
WD40 435 472 5.6e-3 SMART
WD40 478 519 9.6e-2 SMART
WD40 524 563 1.88e-4 SMART
WD40 566 605 3.72e-8 SMART
WD40 648 687 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153812
Meta Mutation Damage Score 0.0714 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930563D23Rik G A 16: 92,321,187 S71L probably benign Het
4931406C07Rik T C 9: 15,291,996 probably null Het
Adamts16 T A 13: 70,768,692 D727V possibly damaging Het
Anxa10 A C 8: 62,076,284 L133* probably null Het
Arfgef3 G A 10: 18,589,666 T2143I probably damaging Het
Arhgef17 T C 7: 100,930,743 T333A probably benign Het
Arhgef40 A G 14: 52,000,993 T1310A probably benign Het
Atg10 C T 13: 90,936,586 probably null Het
Atp1a1 A G 3: 101,584,853 F569S probably damaging Het
Baiap3 A G 17: 25,245,229 W849R possibly damaging Het
Baz1a A T 12: 54,930,312 Y9* probably null Het
Catsperg2 C T 7: 29,705,624 D702N possibly damaging Het
Clasrp G T 7: 19,584,301 probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Col19a1 T C 1: 24,526,386 K288R unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cttnbp2 A G 6: 18,405,178 probably benign Het
Dnah1 T A 14: 31,303,907 I828F probably benign Het
Dpf2 G T 19: 5,907,127 Q23K probably damaging Het
Dsc3 T A 18: 19,981,172 I342F probably damaging Het
Enpp3 A G 10: 24,795,716 L460P probably damaging Het
Epb41l2 A G 10: 25,504,192 E871G probably damaging Het
Exoc2 T C 13: 30,856,797 probably null Het
Fpr-rs7 A T 17: 20,113,626 S201T probably benign Het
Gtf2ird2 T C 5: 134,216,955 F685S probably damaging Het
Helz2 C T 2: 181,240,853 R49H possibly damaging Het
Ica1 A G 6: 8,667,375 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif21a A G 15: 90,997,541 probably null Het
Lamb3 T A 1: 193,330,908 C480* probably null Het
Lamc2 A G 1: 153,152,082 S199P probably damaging Het
Lrfn3 T C 7: 30,360,251 N183S probably benign Het
Lsm14a C A 7: 34,371,045 probably benign Het
Mest C A 6: 30,742,814 H146Q probably damaging Het
Mmp27 T C 9: 7,579,009 V339A probably damaging Het
Myo16 T C 8: 10,376,285 probably benign Het
Myoz1 C T 14: 20,653,611 probably benign Het
Nlrp5 A G 7: 23,417,708 M286V probably benign Het
Olfr1250 A C 2: 89,656,837 N201K possibly damaging Het
Olfr1386 A T 11: 49,470,331 Y60F probably damaging Het
Olfr1537 C T 9: 39,238,429 M1I probably null Het
Olfr273 C T 4: 52,855,566 V316I probably benign Het
Optc T C 1: 133,905,155 K69R probably benign Het
Osbpl3 A T 6: 50,346,377 M242K probably damaging Het
Pdzd9 T A 7: 120,668,401 S64C probably damaging Het
Pik3cg A G 12: 32,195,673 S859P possibly damaging Het
Ppp1r12a G T 10: 108,230,553 A202S possibly damaging Het
Rab32 A T 10: 10,550,867 F112I possibly damaging Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rtn3 A G 19: 7,467,880 probably benign Het
Sbk1 C T 7: 126,291,835 P147L probably damaging Het
Shpk T A 11: 73,204,031 M91K probably damaging Het
Slco6c1 C T 1: 97,128,101 S25N probably benign Het
Snx2 A T 18: 53,194,522 T107S probably benign Het
Tmem131l T C 3: 83,898,417 D1573G probably damaging Het
Tnfrsf8 A G 4: 145,285,138 probably benign Het
Tpmt T C 13: 47,041,489 E36G probably benign Het
Trim30c T A 7: 104,383,481 T257S probably benign Het
Tsc2 A G 17: 24,596,958 L150P probably benign Het
Ttc26 A G 6: 38,425,114 probably null Het
Upf3a G C 8: 13,798,338 G378A possibly damaging Het
Yeats2 A T 16: 20,193,216 K514* probably null Het
Zfp11 A G 5: 129,657,525 Y291H probably benign Het
Zfp457 T C 13: 67,293,314 D399G possibly damaging Het
Other mutations in Tle2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Tle2 APN 10 81581739 missense probably benign 0.12
IGL02651:Tle2 APN 10 81586889 missense probably damaging 1.00
IGL02809:Tle2 APN 10 81586362 unclassified probably null
IGL03235:Tle2 APN 10 81586251 missense probably benign 0.22
IGL03307:Tle2 APN 10 81590240 missense probably damaging 1.00
PIT4515001:Tle2 UTSW 10 81587130 missense possibly damaging 0.72
R0394:Tle2 UTSW 10 81577648 missense probably damaging 1.00
R0744:Tle2 UTSW 10 81588947 missense probably damaging 1.00
R0833:Tle2 UTSW 10 81588947 missense probably damaging 1.00
R1796:Tle2 UTSW 10 81589497 critical splice donor site probably null
R2067:Tle2 UTSW 10 81580551 missense probably damaging 1.00
R2184:Tle2 UTSW 10 81590277 missense probably damaging 1.00
R2198:Tle2 UTSW 10 81590313 missense probably damaging 1.00
R4439:Tle2 UTSW 10 81581682 missense possibly damaging 0.62
R4440:Tle2 UTSW 10 81581682 missense possibly damaging 0.62
R4441:Tle2 UTSW 10 81581682 missense possibly damaging 0.62
R4513:Tle2 UTSW 10 81587560 missense probably damaging 1.00
R4839:Tle2 UTSW 10 81577684 missense probably damaging 1.00
R4863:Tle2 UTSW 10 81588891 missense possibly damaging 0.88
R5011:Tle2 UTSW 10 81584697 missense probably damaging 1.00
R5505:Tle2 UTSW 10 81581740 missense probably benign 0.00
R5538:Tle2 UTSW 10 81580584 missense probably damaging 1.00
R5790:Tle2 UTSW 10 81590315 missense probably damaging 1.00
R5917:Tle2 UTSW 10 81580916 critical splice donor site probably null
R6176:Tle2 UTSW 10 81587334 missense probably damaging 0.99
R6200:Tle2 UTSW 10 81588872 missense probably damaging 1.00
R6914:Tle2 UTSW 10 81586356 missense probably damaging 1.00
R7367:Tle2 UTSW 10 81580318 missense probably damaging 0.99
R7600:Tle2 UTSW 10 81586313 nonsense probably null
R7729:Tle2 UTSW 10 81587147 missense probably damaging 0.99
T0970:Tle2 UTSW 10 81580285 missense possibly damaging 0.71
Z1177:Tle2 UTSW 10 81582446 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCCAGAACACCAATGTGACTTTCC -3'
(R):5'- GTTTTGCCCACATGGCAAGTGC -3'

Sequencing Primer
(F):5'- tagtcgcccagcctctc -3'
(R):5'- gtttgcctcctgaatgctg -3'
Posted On2013-10-16