Incidental Mutation 'R0826:Exoc2'
ID 78251
Institutional Source Beutler Lab
Gene Symbol Exoc2
Ensembl Gene ENSMUSG00000021357
Gene Name exocyst complex component 2
Synonyms 2410030I24Rik, Sec5l1, Sec5, Gm29675
MMRRC Submission 039006-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R0826 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 30972939-31162082 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to C at 31040780 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000021785] [ENSMUST00000021785] [ENSMUST00000102946] [ENSMUST00000102946] [ENSMUST00000102946]
AlphaFold Q9D4H1
Predicted Effect probably null
Transcript: ENSMUST00000021785
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000021785
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000021785
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102946
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102946
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102946
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Meta Mutation Damage Score 0.9501 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,642,480 (GRCm39) T141S probably benign Het
4931406C07Rik T C 9: 15,203,292 (GRCm39) probably null Het
Adamts16 T A 13: 70,916,811 (GRCm39) D727V possibly damaging Het
Anxa10 A C 8: 62,529,318 (GRCm39) L133* probably null Het
Arfgef3 G A 10: 18,465,414 (GRCm39) T2143I probably damaging Het
Arhgef17 T C 7: 100,579,950 (GRCm39) T333A probably benign Het
Arhgef40 A G 14: 52,238,450 (GRCm39) T1310A probably benign Het
Atg10 C T 13: 91,084,705 (GRCm39) probably null Het
Atp1a1 A G 3: 101,492,169 (GRCm39) F569S probably damaging Het
Baiap3 A G 17: 25,464,203 (GRCm39) W849R possibly damaging Het
Baz1a A T 12: 54,977,097 (GRCm39) Y9* probably null Het
Catsperg2 C T 7: 29,405,049 (GRCm39) D702N possibly damaging Het
Clasrp G T 7: 19,318,226 (GRCm39) probably benign Het
Col11a1 G A 3: 113,932,414 (GRCm39) R113H unknown Het
Col19a1 T C 1: 24,565,467 (GRCm39) K288R unknown Het
Ctnnbl1 C T 2: 157,641,337 (GRCm39) probably benign Het
Cttnbp2 A G 6: 18,405,177 (GRCm39) probably benign Het
Dnah1 T A 14: 31,025,864 (GRCm39) I828F probably benign Het
Dpf2 G T 19: 5,957,155 (GRCm39) Q23K probably damaging Het
Dsc3 T A 18: 20,114,229 (GRCm39) I342F probably damaging Het
Enpp3 A G 10: 24,671,614 (GRCm39) L460P probably damaging Het
Epb41l2 A G 10: 25,380,090 (GRCm39) E871G probably damaging Het
Fam243 G A 16: 92,118,075 (GRCm39) S71L probably benign Het
Fpr-rs7 A T 17: 20,333,888 (GRCm39) S201T probably benign Het
Gtf2ird2 T C 5: 134,245,797 (GRCm39) F685S probably damaging Het
Helz2 C T 2: 180,882,646 (GRCm39) R49H possibly damaging Het
Ica1 A G 6: 8,667,375 (GRCm39) probably benign Het
Ift56 A G 6: 38,402,049 (GRCm39) probably null Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Kif21a A G 15: 90,881,744 (GRCm39) probably null Het
Lamb3 T A 1: 193,013,216 (GRCm39) C480* probably null Het
Lamc2 A G 1: 153,027,828 (GRCm39) S199P probably damaging Het
Lrfn3 T C 7: 30,059,676 (GRCm39) N183S probably benign Het
Lsm14a C A 7: 34,070,470 (GRCm39) probably benign Het
Mest C A 6: 30,742,813 (GRCm39) H146Q probably damaging Het
Mmp27 T C 9: 7,579,010 (GRCm39) V339A probably damaging Het
Myo16 T C 8: 10,426,285 (GRCm39) probably benign Het
Myoz1 C T 14: 20,703,679 (GRCm39) probably benign Het
Nlrp5 A G 7: 23,117,133 (GRCm39) M286V probably benign Het
Optc T C 1: 133,832,893 (GRCm39) K69R probably benign Het
Or13c3 C T 4: 52,855,566 (GRCm39) V316I probably benign Het
Or2y1c A T 11: 49,361,158 (GRCm39) Y60F probably damaging Het
Or4a77 A C 2: 89,487,181 (GRCm39) N201K possibly damaging Het
Or8g18 C T 9: 39,149,725 (GRCm39) M1I probably null Het
Osbpl3 A T 6: 50,323,357 (GRCm39) M242K probably damaging Het
Pdzd9 T A 7: 120,267,624 (GRCm39) S64C probably damaging Het
Pik3cg A G 12: 32,245,672 (GRCm39) S859P possibly damaging Het
Ppp1r12a G T 10: 108,066,414 (GRCm39) A202S possibly damaging Het
Rab32 A T 10: 10,426,611 (GRCm39) F112I possibly damaging Het
Ror2 T C 13: 53,267,253 (GRCm39) Y394C probably damaging Het
Rtn3 A G 19: 7,445,245 (GRCm39) probably benign Het
Sbk1 C T 7: 125,891,007 (GRCm39) P147L probably damaging Het
Shpk T A 11: 73,094,857 (GRCm39) M91K probably damaging Het
Slco6c1 C T 1: 97,055,826 (GRCm39) S25N probably benign Het
Snx2 A T 18: 53,327,594 (GRCm39) T107S probably benign Het
Tle2 G A 10: 81,422,148 (GRCm39) V397I possibly damaging Het
Tmem131l T C 3: 83,805,724 (GRCm39) D1573G probably damaging Het
Tnfrsf8 A G 4: 145,011,708 (GRCm39) probably benign Het
Tpmt T C 13: 47,194,965 (GRCm39) E36G probably benign Het
Trim30c T A 7: 104,032,688 (GRCm39) T257S probably benign Het
Tsc2 A G 17: 24,815,932 (GRCm39) L150P probably benign Het
Upf3a G C 8: 13,848,338 (GRCm39) G378A possibly damaging Het
Yeats2 A T 16: 20,011,966 (GRCm39) K514* probably null Het
Zfp11 A G 5: 129,734,589 (GRCm39) Y291H probably benign Het
Zfp457 T C 13: 67,441,378 (GRCm39) D399G possibly damaging Het
Other mutations in Exoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Exoc2 APN 13 31,004,609 (GRCm39) missense probably benign 0.17
IGL01839:Exoc2 APN 13 31,090,782 (GRCm39) missense probably damaging 1.00
IGL02092:Exoc2 APN 13 31,059,260 (GRCm39) missense probably benign 0.09
IGL02245:Exoc2 APN 13 31,090,842 (GRCm39) missense probably benign 0.10
IGL02267:Exoc2 APN 13 30,999,304 (GRCm39) missense probably benign
IGL02478:Exoc2 APN 13 31,111,403 (GRCm39) missense probably benign
IGL02500:Exoc2 APN 13 31,095,179 (GRCm39) missense probably damaging 1.00
IGL03081:Exoc2 APN 13 31,084,885 (GRCm39) missense probably benign 0.28
IGL03112:Exoc2 APN 13 31,090,570 (GRCm39) splice site probably benign
IGL03409:Exoc2 APN 13 31,124,720 (GRCm39) utr 5 prime probably benign
R0284:Exoc2 UTSW 13 31,061,608 (GRCm39) splice site probably benign
R0452:Exoc2 UTSW 13 31,070,310 (GRCm39) splice site probably benign
R1251:Exoc2 UTSW 13 31,070,259 (GRCm39) missense probably benign 0.03
R1367:Exoc2 UTSW 13 31,066,256 (GRCm39) nonsense probably null
R1501:Exoc2 UTSW 13 31,119,485 (GRCm39) missense probably benign 0.01
R1593:Exoc2 UTSW 13 31,040,744 (GRCm39) missense possibly damaging 0.64
R1839:Exoc2 UTSW 13 31,090,480 (GRCm39) splice site probably benign
R1872:Exoc2 UTSW 13 31,006,644 (GRCm39) missense probably benign 0.17
R2064:Exoc2 UTSW 13 31,119,544 (GRCm39) missense probably benign 0.00
R2070:Exoc2 UTSW 13 30,999,353 (GRCm39) missense probably benign 0.00
R2227:Exoc2 UTSW 13 31,048,867 (GRCm39) missense probably benign
R2507:Exoc2 UTSW 13 31,066,348 (GRCm39) missense possibly damaging 0.55
R3965:Exoc2 UTSW 13 31,061,565 (GRCm39) missense probably benign 0.00
R4601:Exoc2 UTSW 13 31,066,251 (GRCm39) missense probably benign 0.05
R4914:Exoc2 UTSW 13 31,060,796 (GRCm39) missense probably benign 0.21
R5299:Exoc2 UTSW 13 31,055,901 (GRCm39) splice site probably null
R5410:Exoc2 UTSW 13 31,048,839 (GRCm39) missense probably damaging 0.98
R5461:Exoc2 UTSW 13 31,109,738 (GRCm39) missense possibly damaging 0.66
R5956:Exoc2 UTSW 13 31,004,606 (GRCm39) missense probably benign 0.03
R6056:Exoc2 UTSW 13 31,084,812 (GRCm39) missense probably benign 0.03
R6107:Exoc2 UTSW 13 31,060,780 (GRCm39) missense probably benign
R6548:Exoc2 UTSW 13 31,010,047 (GRCm39) missense possibly damaging 0.86
R6692:Exoc2 UTSW 13 31,119,490 (GRCm39) missense probably benign 0.09
R6969:Exoc2 UTSW 13 31,095,161 (GRCm39) missense probably benign
R7386:Exoc2 UTSW 13 31,090,646 (GRCm39) splice site probably null
R7461:Exoc2 UTSW 13 31,066,255 (GRCm39) missense probably benign 0.32
R7467:Exoc2 UTSW 13 31,109,716 (GRCm39) missense probably damaging 0.98
R7473:Exoc2 UTSW 13 31,006,613 (GRCm39) critical splice donor site probably null
R7613:Exoc2 UTSW 13 31,066,255 (GRCm39) missense probably benign 0.32
R7767:Exoc2 UTSW 13 31,060,752 (GRCm39) missense probably benign 0.01
R7793:Exoc2 UTSW 13 31,095,161 (GRCm39) missense probably benign 0.00
R7795:Exoc2 UTSW 13 31,060,756 (GRCm39) nonsense probably null
R7993:Exoc2 UTSW 13 31,090,713 (GRCm39) critical splice donor site probably null
R8085:Exoc2 UTSW 13 31,124,686 (GRCm39) missense probably damaging 1.00
R8330:Exoc2 UTSW 13 31,061,556 (GRCm39) missense probably benign
R8716:Exoc2 UTSW 13 31,095,227 (GRCm39) missense probably damaging 1.00
R8735:Exoc2 UTSW 13 31,090,822 (GRCm39) missense probably damaging 1.00
R8922:Exoc2 UTSW 13 31,055,838 (GRCm39) missense probably benign 0.05
R9237:Exoc2 UTSW 13 31,048,858 (GRCm39) missense probably benign
R9243:Exoc2 UTSW 13 31,109,778 (GRCm39) missense probably benign 0.03
R9365:Exoc2 UTSW 13 31,040,697 (GRCm39) missense probably benign 0.00
R9731:Exoc2 UTSW 13 31,061,233 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TATACCCGTCACCATTTGCAGCAGC -3'
(R):5'- TCGGACTACTCAGCACTGAGACAC -3'

Sequencing Primer
(F):5'- TTGCAGCAGCAGAAAATGTTCC -3'
(R):5'- GGAACACTACAGTTGGTGTCC -3'
Posted On 2013-10-16