Mutagenetix > Incidental Mutation

Incidental Mutation 'R0826:Kif21a'

78260

Institutional Source

Beutler Lab

Gene Symbol

Kif21a

Ensembl Gene

ENSMUSG00000022629

Gene Name

kinesin family member 21A

Synonyms

N-5 kinesin

MMRRC Submission

039006-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0826 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90933276-91049948 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 90997541 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000104911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067205] [ENSMUST00000088614] [ENSMUST00000100304] [ENSMUST00000109287] [ENSMUST00000109288]

AlphaFold

Q9QXL2

Predicted Effect

probably null
Transcript: ENSMUST00000067205

SMART Domains

Protein: ENSMUSP00000066911
Gene: ENSMUSG00000022629

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	9e-9	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	557	N/A	INTRINSIC
low complexity region	571	585	N/A	INTRINSIC
low complexity region	589	628	N/A	INTRINSIC
low complexity region	700	713	N/A	INTRINSIC
coiled coil region	924	1008	N/A	INTRINSIC
coiled coil region	1043	1066	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1251	1271	N/A	INTRINSIC
WD40	1290	1327	1.21e-7	SMART
WD40	1330	1368	7.28e-2	SMART
WD40	1394	1432	3.33e-1	SMART
WD40	1435	1477	7e-4	SMART
WD40	1485	1523	2.4e-1	SMART
WD40	1527	1566	1.48e-2	SMART
WD40	1569	1606	2.07e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000088614

SMART Domains

Protein: ENSMUSP00000085985
Gene: ENSMUSG00000022629

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	1e-8	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	564	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
low complexity region	602	641	N/A	INTRINSIC
low complexity region	713	726	N/A	INTRINSIC
coiled coil region	937	1021	N/A	INTRINSIC
coiled coil region	1056	1079	N/A	INTRINSIC
low complexity region	1114	1125	N/A	INTRINSIC
low complexity region	1271	1283	N/A	INTRINSIC
low complexity region	1300	1316	N/A	INTRINSIC
WD40	1334	1371	1.21e-7	SMART
WD40	1374	1412	7.28e-2	SMART
WD40	1438	1476	3.33e-1	SMART
WD40	1479	1521	7e-4	SMART
WD40	1529	1567	2.4e-1	SMART
WD40	1571	1610	1.48e-2	SMART
WD40	1613	1650	2.07e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000100304

SMART Domains

Protein: ENSMUSP00000097877
Gene: ENSMUSG00000022629

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	1e-8	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	564	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
low complexity region	602	641	N/A	INTRINSIC
low complexity region	713	726	N/A	INTRINSIC
coiled coil region	937	1021	N/A	INTRINSIC
coiled coil region	1056	1079	N/A	INTRINSIC
low complexity region	1271	1283	N/A	INTRINSIC
low complexity region	1300	1316	N/A	INTRINSIC
WD40	1334	1371	1.21e-7	SMART
WD40	1374	1412	7.28e-2	SMART
WD40	1438	1476	3.33e-1	SMART
WD40	1479	1521	7e-4	SMART
WD40	1529	1567	2.4e-1	SMART
WD40	1571	1610	1.48e-2	SMART
WD40	1613	1650	2.07e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109287

SMART Domains

Protein: ENSMUSP00000104910
Gene: ENSMUSG00000022629

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	9e-9	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	557	N/A	INTRINSIC
low complexity region	571	585	N/A	INTRINSIC
low complexity region	589	628	N/A	INTRINSIC
low complexity region	700	713	N/A	INTRINSIC
coiled coil region	924	1008	N/A	INTRINSIC
coiled coil region	1043	1066	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC
WD40	1229	1266	1.21e-7	SMART
WD40	1269	1307	7.28e-2	SMART
WD40	1333	1371	3.33e-1	SMART
WD40	1374	1416	7e-4	SMART
WD40	1424	1462	2.4e-1	SMART
WD40	1466	1505	1.48e-2	SMART
WD40	1508	1545	2.07e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109288

SMART Domains

Protein: ENSMUSP00000104911
Gene: ENSMUSG00000022629

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	9e-9	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	557	N/A	INTRINSIC
low complexity region	571	585	N/A	INTRINSIC
low complexity region	589	628	N/A	INTRINSIC
low complexity region	700	713	N/A	INTRINSIC
coiled coil region	924	1008	N/A	INTRINSIC
coiled coil region	1043	1066	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
WD40	1235	1272	1.21e-7	SMART
WD40	1275	1313	7.28e-2	SMART
WD40	1339	1377	3.33e-1	SMART
WD40	1380	1422	7e-4	SMART
WD40	1430	1468	2.4e-1	SMART
WD40	1472	1511	1.48e-2	SMART
WD40	1514	1551	2.07e-6	SMART

Meta Mutation Damage Score

0.9495

Coding Region Coverage

1x: 99.5%
3x: 98.6%
10x: 95.7%
20x: 86.3%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KIF4 subfamily of kinesin-like motor proteins. The encoded protein is characterized by an N-terminal motor domain a coiled-coil stalk domain and a C-terminal WD-40 repeat domain. This protein may be involved in microtubule dependent transport. Mutations in this gene are the cause of congenital fibrosis of extraocular muscles-1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
4930563D23Rik	G	A	16: 92,321,187	S71L	probably benign	Het
4931406C07Rik	T	C	9: 15,291,996		probably null	Het
Adamts16	T	A	13: 70,768,692	D727V	possibly damaging	Het
Anxa10	A	C	8: 62,076,284	L133*	probably null	Het
Arfgef3	G	A	10: 18,589,666	T2143I	probably damaging	Het
Arhgef17	T	C	7: 100,930,743	T333A	probably benign	Het
Arhgef40	A	G	14: 52,000,993	T1310A	probably benign	Het
Atg10	C	T	13: 90,936,586		probably null	Het
Atp1a1	A	G	3: 101,584,853	F569S	probably damaging	Het
Baiap3	A	G	17: 25,245,229	W849R	possibly damaging	Het
Baz1a	A	T	12: 54,930,312	Y9*	probably null	Het
Catsperg2	C	T	7: 29,705,624	D702N	possibly damaging	Het
Clasrp	G	T	7: 19,584,301		probably benign	Het
Col11a1	G	A	3: 114,138,765	R113H	unknown	Het
Col19a1	T	C	1: 24,526,386	K288R	unknown	Het
Ctnnbl1	C	T	2: 157,799,417		probably benign	Het
Cttnbp2	A	G	6: 18,405,178		probably benign	Het
Dnah1	T	A	14: 31,303,907	I828F	probably benign	Het
Dpf2	G	T	19: 5,907,127	Q23K	probably damaging	Het
Dsc3	T	A	18: 19,981,172	I342F	probably damaging	Het
Enpp3	A	G	10: 24,795,716	L460P	probably damaging	Het
Epb41l2	A	G	10: 25,504,192	E871G	probably damaging	Het
Exoc2	T	C	13: 30,856,797		probably null	Het
Fpr-rs7	A	T	17: 20,113,626	S201T	probably benign	Het
Gtf2ird2	T	C	5: 134,216,955	F685S	probably damaging	Het
Helz2	C	T	2: 181,240,853	R49H	possibly damaging	Het
Ica1	A	G	6: 8,667,375		probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Lamb3	T	A	1: 193,330,908	C480*	probably null	Het
Lamc2	A	G	1: 153,152,082	S199P	probably damaging	Het
Lrfn3	T	C	7: 30,360,251	N183S	probably benign	Het
Lsm14a	C	A	7: 34,371,045		probably benign	Het
Mest	C	A	6: 30,742,814	H146Q	probably damaging	Het
Mmp27	T	C	9: 7,579,009	V339A	probably damaging	Het
Myo16	T	C	8: 10,376,285		probably benign	Het
Myoz1	C	T	14: 20,653,611		probably benign	Het
Nlrp5	A	G	7: 23,417,708	M286V	probably benign	Het
Olfr1250	A	C	2: 89,656,837	N201K	possibly damaging	Het
Olfr1386	A	T	11: 49,470,331	Y60F	probably damaging	Het
Olfr1537	C	T	9: 39,238,429	M1I	probably null	Het
Olfr273	C	T	4: 52,855,566	V316I	probably benign	Het
Optc	T	C	1: 133,905,155	K69R	probably benign	Het
Osbpl3	A	T	6: 50,346,377	M242K	probably damaging	Het
Pdzd9	T	A	7: 120,668,401	S64C	probably damaging	Het
Pik3cg	A	G	12: 32,195,673	S859P	possibly damaging	Het
Ppp1r12a	G	T	10: 108,230,553	A202S	possibly damaging	Het
Rab32	A	T	10: 10,550,867	F112I	possibly damaging	Het
Ror2	T	C	13: 53,113,217	Y394C	probably damaging	Het
Rtn3	A	G	19: 7,467,880		probably benign	Het
Sbk1	C	T	7: 126,291,835	P147L	probably damaging	Het
Shpk	T	A	11: 73,204,031	M91K	probably damaging	Het
Slco6c1	C	T	1: 97,128,101	S25N	probably benign	Het
Snx2	A	T	18: 53,194,522	T107S	probably benign	Het
Tle2	G	A	10: 81,586,314	V397I	possibly damaging	Het
Tmem131l	T	C	3: 83,898,417	D1573G	probably damaging	Het
Tnfrsf8	A	G	4: 145,285,138		probably benign	Het
Tpmt	T	C	13: 47,041,489	E36G	probably benign	Het
Trim30c	T	A	7: 104,383,481	T257S	probably benign	Het
Tsc2	A	G	17: 24,596,958	L150P	probably benign	Het
Ttc26	A	G	6: 38,425,114		probably null	Het
Upf3a	G	C	8: 13,798,338	G378A	possibly damaging	Het
Yeats2	A	T	16: 20,193,216	K514*	probably null	Het
Zfp11	A	G	5: 129,657,525	Y291H	probably benign	Het
Zfp457	T	C	13: 67,293,314	D399G	possibly damaging	Het

Other mutations in Kif21a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Kif21a	APN	15	90937301	missense	probably damaging	1.00
IGL01476:Kif21a	APN	15	90943864	missense	possibly damaging	0.66
IGL01617:Kif21a	APN	15	90995637	splice site	probably benign
IGL01736:Kif21a	APN	15	90959745	missense	possibly damaging	0.59
IGL01923:Kif21a	APN	15	90956430	missense	probably damaging	0.96
IGL01985:Kif21a	APN	15	90991767	missense	probably damaging	1.00
IGL02304:Kif21a	APN	15	90965535	missense	probably damaging	1.00
IGL02589:Kif21a	APN	15	90985286	missense	probably damaging	1.00
IGL03115:Kif21a	APN	15	90985395	missense	probably damaging	0.99
IGL03211:Kif21a	APN	15	90997963	missense	possibly damaging	0.73
IGL03372:Kif21a	APN	15	90956376	missense	probably benign	0.38
reflex	UTSW	15	90968358	missense	probably null	1.00
R0052:Kif21a	UTSW	15	90970857	missense	probably damaging	0.98
R0052:Kif21a	UTSW	15	90970857	missense	probably damaging	0.98
R0304:Kif21a	UTSW	15	90976521	splice site	probably null
R0378:Kif21a	UTSW	15	90969774	splice site	probably null
R0420:Kif21a	UTSW	15	90968054	unclassified	probably benign
R0536:Kif21a	UTSW	15	90959683	splice site	probably benign
R0971:Kif21a	UTSW	15	90940581	missense	possibly damaging	0.46
R1052:Kif21a	UTSW	15	90935650	missense	probably benign	0.17
R1168:Kif21a	UTSW	15	90993753	missense	probably damaging	1.00
R1324:Kif21a	UTSW	15	90948322	critical splice donor site	probably null
R1471:Kif21a	UTSW	15	90956419	missense	probably benign	0.04
R1625:Kif21a	UTSW	15	90942175	missense	probably damaging	1.00
R1636:Kif21a	UTSW	15	90984805	splice site	probably benign
R1647:Kif21a	UTSW	15	90994367	missense	probably damaging	1.00
R1648:Kif21a	UTSW	15	90994367	missense	probably damaging	1.00
R1699:Kif21a	UTSW	15	90959743	missense	probably damaging	0.99
R1703:Kif21a	UTSW	15	90949047	splice site	probably null
R1795:Kif21a	UTSW	15	90972727	splice site	probably null
R1812:Kif21a	UTSW	15	90971766	missense	possibly damaging	0.63
R1959:Kif21a	UTSW	15	90970848	missense	probably damaging	0.99
R1960:Kif21a	UTSW	15	90970848	missense	probably damaging	0.99
R1961:Kif21a	UTSW	15	90970848	missense	probably damaging	0.99
R1996:Kif21a	UTSW	15	90994371	nonsense	probably null
R2230:Kif21a	UTSW	15	90985362	nonsense	probably null
R2231:Kif21a	UTSW	15	90985362	nonsense	probably null
R2232:Kif21a	UTSW	15	90985362	nonsense	probably null
R2424:Kif21a	UTSW	15	90971196	missense	probably damaging	1.00
R2429:Kif21a	UTSW	15	90998005	missense	probably damaging	1.00
R2513:Kif21a	UTSW	15	90994391	missense	possibly damaging	0.96
R2846:Kif21a	UTSW	15	90934464	missense	probably benign
R3027:Kif21a	UTSW	15	90972642	missense	probably damaging	0.99
R3624:Kif21a	UTSW	15	90965595	missense	probably damaging	0.99
R3820:Kif21a	UTSW	15	90968074	missense	probably benign	0.17
R3923:Kif21a	UTSW	15	90937294	missense	possibly damaging	0.46
R3962:Kif21a	UTSW	15	90985409	missense	probably damaging	1.00
R4355:Kif21a	UTSW	15	90970833	missense	probably benign	0.17
R4516:Kif21a	UTSW	15	90971142	missense	probably benign	0.38
R4530:Kif21a	UTSW	15	90968089	splice site	probably null
R4612:Kif21a	UTSW	15	90968223	splice site	probably null
R4674:Kif21a	UTSW	15	90940545	missense	possibly damaging	0.66
R4675:Kif21a	UTSW	15	90940545	missense	possibly damaging	0.66
R4698:Kif21a	UTSW	15	90956305	missense	possibly damaging	0.85
R4712:Kif21a	UTSW	15	90984755	missense	probably damaging	1.00
R4955:Kif21a	UTSW	15	90937190	missense	probably damaging	1.00
R4974:Kif21a	UTSW	15	90949010	missense	probably benign	0.16
R5034:Kif21a	UTSW	15	90968358	missense	probably null	1.00
R5165:Kif21a	UTSW	15	90956376	missense	probably benign	0.38
R5464:Kif21a	UTSW	15	90993855	missense	probably damaging	1.00
R5541:Kif21a	UTSW	15	90968113	missense	probably damaging	0.99
R5757:Kif21a	UTSW	15	90951345	missense	probably damaging	1.00
R5936:Kif21a	UTSW	15	90935647	missense	possibly damaging	0.95
R5976:Kif21a	UTSW	15	90935812	missense	probably damaging	1.00
R6074:Kif21a	UTSW	15	90980892	missense	probably benign
R6638:Kif21a	UTSW	15	90966407	missense	probably damaging	1.00
R6723:Kif21a	UTSW	15	90940446	missense	probably damaging	0.97
R6785:Kif21a	UTSW	15	90935730	missense	probably damaging	1.00
R6977:Kif21a	UTSW	15	90980837	missense	probably damaging	1.00
R7058:Kif21a	UTSW	15	90948903	splice site	probably null
R7147:Kif21a	UTSW	15	90980883	missense	probably benign	0.13
R7290:Kif21a	UTSW	15	90967229	nonsense	probably null
R7438:Kif21a	UTSW	15	90993796	missense	probably benign	0.37
R7593:Kif21a	UTSW	15	90943861	missense	probably benign	0.03
R7661:Kif21a	UTSW	15	90980919	missense	possibly damaging	0.89
R7891:Kif21a	UTSW	15	90956314	missense	probably damaging	1.00
R8137:Kif21a	UTSW	15	90968442	missense	probably benign
R8182:Kif21a	UTSW	15	90935761	missense	possibly damaging	0.77
R8303:Kif21a	UTSW	15	90971196	missense	probably damaging	0.99
R8388:Kif21a	UTSW	15	90959124	missense	possibly damaging	0.60
R8867:Kif21a	UTSW	15	90968179	missense	probably damaging	0.96
R8921:Kif21a	UTSW	15	90971727	missense	probably benign	0.04
R8984:Kif21a	UTSW	15	90956356	missense	probably benign	0.00
R9024:Kif21a	UTSW	15	90937196	nonsense	probably null
R9254:Kif21a	UTSW	15	90969827	missense	probably damaging	0.99
R9366:Kif21a	UTSW	15	90959748	missense	probably damaging	0.99
R9379:Kif21a	UTSW	15	90969827	missense	probably damaging	0.99
R9393:Kif21a	UTSW	15	90969778	missense	probably benign	0.00
R9518:Kif21a	UTSW	15	90956473	missense	probably damaging	1.00
R9712:Kif21a	UTSW	15	90985325	missense	probably damaging	0.98
R9712:Kif21a	UTSW	15	90995512	missense	probably benign	0.13
R9721:Kif21a	UTSW	15	90971127	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCAGCCTCTGAAGCCATTTCTCAAC -3'
(R):5'- ACACGATGGGAACCGGATTTGAC -3'

Sequencing Primer
(F):5'- TAACTCCTAGCACTTTATAAGCCG -3'
(R):5'- CCGGATTTGACGTGAACATC -3'

Posted On

2013-10-16