Incidental Mutation 'R0826:Baiap3'
ID 78265
Institutional Source Beutler Lab
Gene Symbol Baiap3
Ensembl Gene ENSMUSG00000047507
Gene Name BAI1-associated protein 3
Synonyms LOC381076
MMRRC Submission 039006-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0826 (G1)
Quality Score 198
Status Validated
Chromosome 17
Chromosomal Location 25461633-25475255 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25464203 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 849 (W849R)
Ref Sequence ENSEMBL: ENSMUSP00000138254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063574] [ENSMUST00000169109] [ENSMUST00000182056] [ENSMUST00000182435] [ENSMUST00000182825]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000063574
SMART Domains Protein: ENSMUSP00000068511
Gene: ENSMUSG00000015126

DomainStartEndE-ValueType
Pfam:RLI 58 92 8.2e-17 PFAM
Pfam:DUF367 96 222 1.3e-56 PFAM
low complexity region 261 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169109
AA Change: W862R

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129854
Gene: ENSMUSG00000047507
AA Change: W862R

DomainStartEndE-ValueType
C2 159 328 4.73e-17 SMART
low complexity region 361 379 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 497 509 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 857 868 N/A INTRINSIC
Pfam:Membr_traf_MHD 896 958 8e-10 PFAM
C2 989 1097 7.06e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175461
Predicted Effect probably benign
Transcript: ENSMUST00000182056
AA Change: W885R

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138188
Gene: ENSMUSG00000047507
AA Change: W885R

DomainStartEndE-ValueType
C2 159 328 4.73e-17 SMART
low complexity region 361 379 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 497 509 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
Pfam:Membr_traf_MHD 851 959 3.3e-30 PFAM
C2 989 1097 7.06e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182126
Predicted Effect probably benign
Transcript: ENSMUST00000182435
AA Change: W857R

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138796
Gene: ENSMUSG00000047507
AA Change: W857R

DomainStartEndE-ValueType
C2 131 300 4.73e-17 SMART
low complexity region 333 351 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Membr_traf_MHD 823 931 3.2e-30 PFAM
C2 961 1069 7.06e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182825
AA Change: W849R

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138254
Gene: ENSMUSG00000047507
AA Change: W849R

DomainStartEndE-ValueType
C2 159 284 4.05e-16 SMART
low complexity region 325 343 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 461 473 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
Pfam:Membr_traf_MHD 815 923 3.2e-30 PFAM
C2 953 1061 7.06e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182903
Predicted Effect probably benign
Transcript: ENSMUST00000182696
Meta Mutation Damage Score 0.8992 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor. The protein is a seven-span transmembrane protein and a member of the secretin receptor family. It interacts with the cytoplasmic region of brain-specific angiogenesis inhibitor 1. This protein also contains two C2 domains, which are often found in proteins involved in signal transduction or membrane trafficking. Its expression pattern and similarity to other proteins suggest that it may be involved in synaptic functions. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile but exhibit increased PTZ-induced seizure propensity, as well as increased novelty-induced anxiety in both genders, with a more pronounced effect in females, and a faster developmentof tolerance to benzodiazepines in male mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,642,480 (GRCm39) T141S probably benign Het
4931406C07Rik T C 9: 15,203,292 (GRCm39) probably null Het
Adamts16 T A 13: 70,916,811 (GRCm39) D727V possibly damaging Het
Anxa10 A C 8: 62,529,318 (GRCm39) L133* probably null Het
Arfgef3 G A 10: 18,465,414 (GRCm39) T2143I probably damaging Het
Arhgef17 T C 7: 100,579,950 (GRCm39) T333A probably benign Het
Arhgef40 A G 14: 52,238,450 (GRCm39) T1310A probably benign Het
Atg10 C T 13: 91,084,705 (GRCm39) probably null Het
Atp1a1 A G 3: 101,492,169 (GRCm39) F569S probably damaging Het
Baz1a A T 12: 54,977,097 (GRCm39) Y9* probably null Het
Catsperg2 C T 7: 29,405,049 (GRCm39) D702N possibly damaging Het
Clasrp G T 7: 19,318,226 (GRCm39) probably benign Het
Col11a1 G A 3: 113,932,414 (GRCm39) R113H unknown Het
Col19a1 T C 1: 24,565,467 (GRCm39) K288R unknown Het
Ctnnbl1 C T 2: 157,641,337 (GRCm39) probably benign Het
Cttnbp2 A G 6: 18,405,177 (GRCm39) probably benign Het
Dnah1 T A 14: 31,025,864 (GRCm39) I828F probably benign Het
Dpf2 G T 19: 5,957,155 (GRCm39) Q23K probably damaging Het
Dsc3 T A 18: 20,114,229 (GRCm39) I342F probably damaging Het
Enpp3 A G 10: 24,671,614 (GRCm39) L460P probably damaging Het
Epb41l2 A G 10: 25,380,090 (GRCm39) E871G probably damaging Het
Exoc2 T C 13: 31,040,780 (GRCm39) probably null Het
Fam243 G A 16: 92,118,075 (GRCm39) S71L probably benign Het
Fpr-rs7 A T 17: 20,333,888 (GRCm39) S201T probably benign Het
Gtf2ird2 T C 5: 134,245,797 (GRCm39) F685S probably damaging Het
Helz2 C T 2: 180,882,646 (GRCm39) R49H possibly damaging Het
Ica1 A G 6: 8,667,375 (GRCm39) probably benign Het
Ift56 A G 6: 38,402,049 (GRCm39) probably null Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Kif21a A G 15: 90,881,744 (GRCm39) probably null Het
Lamb3 T A 1: 193,013,216 (GRCm39) C480* probably null Het
Lamc2 A G 1: 153,027,828 (GRCm39) S199P probably damaging Het
Lrfn3 T C 7: 30,059,676 (GRCm39) N183S probably benign Het
Lsm14a C A 7: 34,070,470 (GRCm39) probably benign Het
Mest C A 6: 30,742,813 (GRCm39) H146Q probably damaging Het
Mmp27 T C 9: 7,579,010 (GRCm39) V339A probably damaging Het
Myo16 T C 8: 10,426,285 (GRCm39) probably benign Het
Myoz1 C T 14: 20,703,679 (GRCm39) probably benign Het
Nlrp5 A G 7: 23,117,133 (GRCm39) M286V probably benign Het
Optc T C 1: 133,832,893 (GRCm39) K69R probably benign Het
Or13c3 C T 4: 52,855,566 (GRCm39) V316I probably benign Het
Or2y1c A T 11: 49,361,158 (GRCm39) Y60F probably damaging Het
Or4a77 A C 2: 89,487,181 (GRCm39) N201K possibly damaging Het
Or8g18 C T 9: 39,149,725 (GRCm39) M1I probably null Het
Osbpl3 A T 6: 50,323,357 (GRCm39) M242K probably damaging Het
Pdzd9 T A 7: 120,267,624 (GRCm39) S64C probably damaging Het
Pik3cg A G 12: 32,245,672 (GRCm39) S859P possibly damaging Het
Ppp1r12a G T 10: 108,066,414 (GRCm39) A202S possibly damaging Het
Rab32 A T 10: 10,426,611 (GRCm39) F112I possibly damaging Het
Ror2 T C 13: 53,267,253 (GRCm39) Y394C probably damaging Het
Rtn3 A G 19: 7,445,245 (GRCm39) probably benign Het
Sbk1 C T 7: 125,891,007 (GRCm39) P147L probably damaging Het
Shpk T A 11: 73,094,857 (GRCm39) M91K probably damaging Het
Slco6c1 C T 1: 97,055,826 (GRCm39) S25N probably benign Het
Snx2 A T 18: 53,327,594 (GRCm39) T107S probably benign Het
Tle2 G A 10: 81,422,148 (GRCm39) V397I possibly damaging Het
Tmem131l T C 3: 83,805,724 (GRCm39) D1573G probably damaging Het
Tnfrsf8 A G 4: 145,011,708 (GRCm39) probably benign Het
Tpmt T C 13: 47,194,965 (GRCm39) E36G probably benign Het
Trim30c T A 7: 104,032,688 (GRCm39) T257S probably benign Het
Tsc2 A G 17: 24,815,932 (GRCm39) L150P probably benign Het
Upf3a G C 8: 13,848,338 (GRCm39) G378A possibly damaging Het
Yeats2 A T 16: 20,011,966 (GRCm39) K514* probably null Het
Zfp11 A G 5: 129,734,589 (GRCm39) Y291H probably benign Het
Zfp457 T C 13: 67,441,378 (GRCm39) D399G possibly damaging Het
Other mutations in Baiap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Baiap3 APN 17 25,463,302 (GRCm39) missense probably damaging 1.00
IGL00486:Baiap3 APN 17 25,467,351 (GRCm39) splice site probably benign
IGL00820:Baiap3 APN 17 25,467,664 (GRCm39) missense probably benign 0.20
IGL01443:Baiap3 APN 17 25,464,121 (GRCm39) missense possibly damaging 0.92
IGL02282:Baiap3 APN 17 25,468,351 (GRCm39) missense probably benign 0.11
IGL02341:Baiap3 APN 17 25,467,290 (GRCm39) missense possibly damaging 0.52
IGL02669:Baiap3 APN 17 25,463,322 (GRCm39) missense probably damaging 1.00
IGL02863:Baiap3 APN 17 25,463,476 (GRCm39) splice site probably benign
IGL02993:Baiap3 APN 17 25,469,056 (GRCm39) critical splice donor site probably null
R0021:Baiap3 UTSW 17 25,462,643 (GRCm39) missense probably damaging 1.00
R0090:Baiap3 UTSW 17 25,469,044 (GRCm39) splice site probably benign
R0276:Baiap3 UTSW 17 25,462,661 (GRCm39) missense probably damaging 1.00
R0488:Baiap3 UTSW 17 25,467,444 (GRCm39) critical splice donor site probably null
R0883:Baiap3 UTSW 17 25,468,075 (GRCm39) missense probably damaging 1.00
R1700:Baiap3 UTSW 17 25,468,302 (GRCm39) missense probably damaging 1.00
R1702:Baiap3 UTSW 17 25,463,779 (GRCm39) missense probably damaging 1.00
R2336:Baiap3 UTSW 17 25,469,378 (GRCm39) missense probably damaging 1.00
R2762:Baiap3 UTSW 17 25,463,549 (GRCm39) missense probably damaging 1.00
R4454:Baiap3 UTSW 17 25,468,510 (GRCm39) missense probably damaging 1.00
R4540:Baiap3 UTSW 17 25,465,644 (GRCm39) missense probably damaging 1.00
R4609:Baiap3 UTSW 17 25,469,235 (GRCm39) missense probably damaging 1.00
R4816:Baiap3 UTSW 17 25,466,269 (GRCm39) splice site probably benign
R4979:Baiap3 UTSW 17 25,465,336 (GRCm39) missense possibly damaging 0.57
R5069:Baiap3 UTSW 17 25,468,082 (GRCm39) missense probably damaging 0.99
R5070:Baiap3 UTSW 17 25,468,082 (GRCm39) missense probably damaging 0.99
R5093:Baiap3 UTSW 17 25,469,243 (GRCm39) missense probably damaging 1.00
R5130:Baiap3 UTSW 17 25,464,316 (GRCm39) missense probably benign 0.01
R5566:Baiap3 UTSW 17 25,470,707 (GRCm39) missense probably damaging 1.00
R5572:Baiap3 UTSW 17 25,470,449 (GRCm39) missense possibly damaging 0.86
R5681:Baiap3 UTSW 17 25,468,347 (GRCm39) missense probably damaging 1.00
R5730:Baiap3 UTSW 17 25,466,498 (GRCm39) missense probably benign 0.01
R5743:Baiap3 UTSW 17 25,463,759 (GRCm39) missense probably benign 0.02
R5805:Baiap3 UTSW 17 25,466,489 (GRCm39) missense probably benign 0.12
R6038:Baiap3 UTSW 17 25,465,308 (GRCm39) missense probably damaging 1.00
R6038:Baiap3 UTSW 17 25,465,308 (GRCm39) missense probably damaging 1.00
R6052:Baiap3 UTSW 17 25,467,444 (GRCm39) critical splice donor site probably benign
R6238:Baiap3 UTSW 17 25,464,732 (GRCm39) missense probably benign 0.00
R6700:Baiap3 UTSW 17 25,463,000 (GRCm39) missense probably damaging 1.00
R7037:Baiap3 UTSW 17 25,462,814 (GRCm39) missense probably benign
R7038:Baiap3 UTSW 17 25,462,814 (GRCm39) missense probably benign
R7039:Baiap3 UTSW 17 25,462,814 (GRCm39) missense probably benign
R7126:Baiap3 UTSW 17 25,464,119 (GRCm39) missense possibly damaging 0.64
R7198:Baiap3 UTSW 17 25,462,814 (GRCm39) missense probably benign
R7223:Baiap3 UTSW 17 25,462,814 (GRCm39) missense probably benign
R7291:Baiap3 UTSW 17 25,463,291 (GRCm39) missense probably damaging 1.00
R7438:Baiap3 UTSW 17 25,468,082 (GRCm39) missense possibly damaging 0.91
R7687:Baiap3 UTSW 17 25,468,311 (GRCm39) missense possibly damaging 0.88
R7877:Baiap3 UTSW 17 25,470,112 (GRCm39) missense probably damaging 0.99
R8172:Baiap3 UTSW 17 25,463,096 (GRCm39) missense probably damaging 1.00
R8184:Baiap3 UTSW 17 25,467,499 (GRCm39) missense probably benign 0.00
R8230:Baiap3 UTSW 17 25,465,827 (GRCm39) missense probably benign 0.00
R8240:Baiap3 UTSW 17 25,464,288 (GRCm39) critical splice donor site probably null
R8394:Baiap3 UTSW 17 25,469,096 (GRCm39) missense probably benign
R8972:Baiap3 UTSW 17 25,466,010 (GRCm39) missense probably benign 0.04
R9274:Baiap3 UTSW 17 25,463,354 (GRCm39) missense probably damaging 0.96
R9333:Baiap3 UTSW 17 25,467,676 (GRCm39) missense possibly damaging 0.54
R9388:Baiap3 UTSW 17 25,466,109 (GRCm39) critical splice donor site probably null
X0017:Baiap3 UTSW 17 25,467,324 (GRCm39) missense possibly damaging 0.92
Z1176:Baiap3 UTSW 17 25,463,742 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TCCCTCGGCATGGAAGAAACTGAC -3'
(R):5'- CCCCTGACTCGATTCAGAACGATG -3'

Sequencing Primer
(F):5'- ATTTGAAGTGCCTTAGACACCC -3'
(R):5'- CTCGATTCAGAACGATGAGGTAAG -3'
Posted On 2013-10-16