Mutagenetix > Incidental Mutation

Incidental Mutation 'R0827:Uggt1'

78271

Institutional Source

Beutler Lab

Gene Symbol

Uggt1

Ensembl Gene

ENSMUSG00000037470

Gene Name

UDP-glucose glycoprotein glucosyltransferase 1

Synonyms

Ugcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik

MMRRC Submission

039007-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.450) question?

Stock #

R0827 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36140027-36244720 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 36156313 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000037930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000174266]

AlphaFold

Q6P5E4

Predicted Effect

probably null
Transcript: ENSMUST00000046875

SMART Domains

Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
Pfam:UDP-g_GGTase	44	1222	N/A	PFAM
SCOP:d1ga8a_	1256	1521	3e-45	SMART
Blast:BROMO	1414	1453	3e-17	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173999

Predicted Effect

probably benign
Transcript: ENSMUST00000174266

SMART Domains

Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
low complexity region	88	97	N/A	INTRINSIC

Meta Mutation Damage Score

0.9590

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 93.6%

Validation Efficiency

100% (88/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	C	7: 79,099,671	S1397P	probably benign	Het
Adamts15	T	C	9: 30,921,480	Y253C	probably damaging	Het
Ankk1	A	G	9: 49,421,737	I149T	possibly damaging	Het
Ankrd63	A	G	2: 118,702,553	S296P	possibly damaging	Het
Arpc1b	T	G	5: 145,125,756	C227G	probably benign	Het
B4gat1	A	G	19: 5,039,697	R241G	possibly damaging	Het
Ccar2	T	C	14: 70,139,838	N751D	probably benign	Het
Cd55b	T	C	1: 130,414,236	I221M	probably damaging	Het
Cntn5	A	G	9: 9,666,938	V1032A	possibly damaging	Het
Col11a1	G	A	3: 114,138,765	R113H	unknown	Het
Colec10	G	A	15: 54,462,584	C270Y	probably damaging	Het
Ctnnbl1	C	T	2: 157,799,417		probably benign	Het
Cyp2j12	T	G	4: 96,112,862		probably benign	Het
Dennd5a	G	A	7: 109,899,731	T999M	probably damaging	Het
Dusp13	C	A	14: 21,742,771	V29L	probably benign	Het
Efr3a	A	C	15: 65,853,551	D83A	possibly damaging	Het
Elmod2	A	G	8: 83,316,795		probably null	Het
Eml3	C	A	19: 8,938,466	T640K	probably damaging	Het
Eps8l1	T	C	7: 4,477,389	V543A	possibly damaging	Het
Ermn	T	C	2: 58,048,251	K117E	probably damaging	Het
F830045P16Rik	A	G	2: 129,472,776	S194P	probably benign	Het
Faim2	A	G	15: 99,524,736	V60A	probably benign	Het
Fancd2	G	A	6: 113,586,249		probably null	Het
Fbxo43	A	T	15: 36,162,969	S31T	possibly damaging	Het
Gab2	G	A	7: 97,300,332	R411Q	probably damaging	Het
Gm17727	A	T	9: 35,777,851	L12Q	probably damaging	Het
Gpm6a	A	T	8: 55,058,883	D264V	probably damaging	Het
Hist1h1t	A	G	13: 23,696,221	D119G	probably benign	Het
Hsp90aa1	T	C	12: 110,692,695	E556G	probably benign	Het
Ifi203	A	T	1: 173,928,463		probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Kcnc3	A	G	7: 44,595,206	T307A	probably damaging	Het
Kin	C	A	2: 10,090,376		probably benign	Het
Knl1	T	C	2: 119,088,901		probably benign	Het
Lrp4	G	A	2: 91,495,041	V1404M	probably damaging	Het
Lrrc71	T	A	3: 87,742,645		probably null	Het
Med13l	T	C	5: 118,726,247		probably benign	Het
Mfap5	A	G	6: 122,520,920	D39G	probably damaging	Het
Mlxipl	T	C	5: 135,132,738	S504P	probably benign	Het
Myo3a	T	G	2: 22,558,215	Y1D	probably damaging	Het
Nek1	A	G	8: 61,105,648		probably benign	Het
Nfkbiz	T	C	16: 55,816,367	R524G	probably damaging	Het
Npbwr1	T	C	1: 5,916,789	T169A	possibly damaging	Het
Nuggc	T	C	14: 65,608,891	Y84H	probably damaging	Het
Nxph3	G	A	11: 95,511,426	S54L	probably benign	Het
Olfr311	T	C	11: 58,841,771	I219T	probably damaging	Het
Olfr532	A	G	7: 140,419,467	F102S	probably damaging	Het
Ostn	A	G	16: 27,324,631	N70D	probably damaging	Het
Pcdhb2	G	A	18: 37,295,657	V228I	possibly damaging	Het
Pnpla6	A	T	8: 3,517,618	M109L	possibly damaging	Het
Ppil6	T	A	10: 41,494,504		probably benign	Het
Prss46	A	G	9: 110,851,432	N215S	probably benign	Het
Ptprd	A	T	4: 76,128,915	D371E	probably damaging	Het
Ripor2	T	A	13: 24,694,186	F315I	probably damaging	Het
Rmi2	G	A	16: 10,835,240	G51S	probably damaging	Het
Scg3	A	G	9: 75,683,697	I10T	possibly damaging	Het
Scn9a	T	A	2: 66,536,124	K761*	probably null	Het
Scyl2	A	G	10: 89,657,865	L347P	possibly damaging	Het
Sh3d21	A	G	4: 126,152,271		probably benign	Het
Shc1	T	A	3: 89,426,783		probably null	Het
Slbp	A	G	5: 33,643,822	S182P	probably damaging	Het
Slc24a1	C	T	9: 64,928,190	G885D	probably benign	Het
Slc24a3	T	C	2: 145,518,492		probably benign	Het
Sowahb	T	G	5: 93,043,286	N525H	probably damaging	Het
Sppl3	T	A	5: 115,082,333	C101*	probably null	Het
Srsf5	A	G	12: 80,949,540	K163E	probably damaging	Het
Sult2a4	A	G	7: 13,984,961	I119T	probably benign	Het
Svep1	A	G	4: 58,053,113		probably benign	Het
Tas1r3	G	A	4: 155,860,869	R632W	probably benign	Het
Tlr4	T	A	4: 66,833,880		probably null	Het
Tmf1	A	C	6: 97,158,050	L1001*	probably null	Het
Tnnt2	A	G	1: 135,843,796		probably benign	Het
Trank1	G	A	9: 111,349,417		probably benign	Het
Trdn	A	T	10: 33,399,158		probably benign	Het
Trmt6	A	T	2: 132,815,834	V34E	probably damaging	Het
Trrap	T	C	5: 144,814,830	F1699L	probably benign	Het
Ttk	A	G	9: 83,843,915	R250G	probably benign	Het
Ttn	T	A	2: 76,809,904	I13787F	probably damaging	Het
Ugt2b35	T	A	5: 87,008,130		probably benign	Het
Ugt2b36	C	A	5: 87,066,375	R470L	possibly damaging	Het
Unk	A	G	11: 116,053,109	D352G	possibly damaging	Het
Vmn2r77	G	T	7: 86,802,016	C370F	probably damaging	Het
Vmn2r85	A	G	10: 130,429,518	I32T	possibly damaging	Het
Zfp637	A	G	6: 117,845,444	I178V	possibly damaging	Het
Zfp943	A	G	17: 21,992,090		probably null	Het
Zyg11a	A	G	4: 108,210,042		probably benign	Het

Other mutations in Uggt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Uggt1	APN	1	36179552	splice site	probably benign
IGL00817:Uggt1	APN	1	36185932	missense	probably benign	0.03
IGL01395:Uggt1	APN	1	36155077	missense	probably damaging	1.00
IGL01609:Uggt1	APN	1	36182474	missense	probably damaging	1.00
IGL01619:Uggt1	APN	1	36161694	missense	probably damaging	0.99
IGL02077:Uggt1	APN	1	36176794	missense	probably damaging	0.99
IGL02313:Uggt1	APN	1	36184484	missense	probably damaging	0.99
IGL02341:Uggt1	APN	1	36164519	makesense	probably null
IGL02346:Uggt1	APN	1	36179670	missense	probably benign	0.00
IGL02447:Uggt1	APN	1	36150142	missense	probably damaging	1.00
IGL02883:Uggt1	APN	1	36177615	missense	probably benign	0.03
IGL02930:Uggt1	APN	1	36157456	missense	probably benign	0.01
IGL03153:Uggt1	APN	1	36202818	missense	possibly damaging	0.94
IGL03162:Uggt1	APN	1	36207956	missense	probably damaging	1.00
IGL03170:Uggt1	APN	1	36163261	missense	probably damaging	1.00
IGL03266:Uggt1	APN	1	36150048	missense	probably damaging	1.00
K3955:Uggt1	UTSW	1	36162353	missense	probably benign	0.37
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0167:Uggt1	UTSW	1	36170197	critical splice donor site	probably null
R0373:Uggt1	UTSW	1	36179670	missense	probably benign	0.00
R0502:Uggt1	UTSW	1	36159946	missense	probably damaging	1.00
R0546:Uggt1	UTSW	1	36195971	missense	probably benign	0.00
R0610:Uggt1	UTSW	1	36165506	splice site	probably benign
R0671:Uggt1	UTSW	1	36155128	missense	probably damaging	1.00
R0760:Uggt1	UTSW	1	36161724	missense	possibly damaging	0.68
R0825:Uggt1	UTSW	1	36158143	missense	probably benign	0.01
R0884:Uggt1	UTSW	1	36175078	missense	probably benign	0.00
R1112:Uggt1	UTSW	1	36173546	missense	possibly damaging	0.54
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1592:Uggt1	UTSW	1	36202858	missense	probably benign	0.04
R1730:Uggt1	UTSW	1	36221261	missense	probably benign	0.05
R1923:Uggt1	UTSW	1	36179613	missense	probably damaging	0.99
R1970:Uggt1	UTSW	1	36151781	missense	probably damaging	1.00
R2086:Uggt1	UTSW	1	36192414	missense	probably null	1.00
R2829:Uggt1	UTSW	1	36162294	missense	probably benign	0.38
R3431:Uggt1	UTSW	1	36210059	nonsense	probably null
R3432:Uggt1	UTSW	1	36210059	nonsense	probably null
R3725:Uggt1	UTSW	1	36182507	nonsense	probably null
R3880:Uggt1	UTSW	1	36176804	intron	probably benign
R4052:Uggt1	UTSW	1	36164489	missense	probably damaging	0.98
R4133:Uggt1	UTSW	1	36158159	missense	probably damaging	1.00
R4489:Uggt1	UTSW	1	36146668	nonsense	probably null
R4570:Uggt1	UTSW	1	36150073	missense	probably damaging	1.00
R4866:Uggt1	UTSW	1	36202855	nonsense	probably null
R4895:Uggt1	UTSW	1	36156264	missense	probably damaging	1.00
R4900:Uggt1	UTSW	1	36202855	nonsense	probably null
R5372:Uggt1	UTSW	1	36244060	splice site	probably benign
R5385:Uggt1	UTSW	1	36184412	missense	probably damaging	1.00
R5652:Uggt1	UTSW	1	36216153	nonsense	probably null
R5694:Uggt1	UTSW	1	36179656	missense	probably damaging	1.00
R5732:Uggt1	UTSW	1	36161771	splice site	probably null
R5893:Uggt1	UTSW	1	36227628	splice site	probably null
R6191:Uggt1	UTSW	1	36162208	missense	probably damaging	0.98
R6247:Uggt1	UTSW	1	36163228	missense	probably damaging	1.00
R6259:Uggt1	UTSW	1	36234916	missense	probably benign	0.00
R6399:Uggt1	UTSW	1	36163366	missense	possibly damaging	0.90
R6439:Uggt1	UTSW	1	36174951	missense	possibly damaging	0.95
R6468:Uggt1	UTSW	1	36173450	missense	probably benign	0.00
R6788:Uggt1	UTSW	1	36230688	missense	probably benign	0.00
R7165:Uggt1	UTSW	1	36155107	missense	probably benign	0.41
R7255:Uggt1	UTSW	1	36146106	missense	probably damaging	1.00
R7273:Uggt1	UTSW	1	36162221	missense	probably damaging	0.99
R7469:Uggt1	UTSW	1	36151733	missense	probably damaging	1.00
R7490:Uggt1	UTSW	1	36164508	missense	probably benign	0.01
R7570:Uggt1	UTSW	1	36185838	missense	probably benign	0.09
R7612:Uggt1	UTSW	1	36163235	missense	probably damaging	0.99
R7759:Uggt1	UTSW	1	36146725	missense	possibly damaging	0.81
R7792:Uggt1	UTSW	1	36207984	missense	probably damaging	1.00
R7816:Uggt1	UTSW	1	36163315	missense	possibly damaging	0.95
R7858:Uggt1	UTSW	1	36156258	missense	probably damaging	1.00
R7887:Uggt1	UTSW	1	36208034	missense	probably damaging	0.99
R8040:Uggt1	UTSW	1	36211473	missense	possibly damaging	0.70
R8093:Uggt1	UTSW	1	36227485	missense	probably damaging	1.00
R8245:Uggt1	UTSW	1	36165564	missense	probably damaging	1.00
R8338:Uggt1	UTSW	1	36227521	missense	probably damaging	1.00
R8353:Uggt1	UTSW	1	36170296	critical splice acceptor site	probably null
R8442:Uggt1	UTSW	1	36173487	missense	probably damaging	0.99
R8519:Uggt1	UTSW	1	36176643	splice site	probably null
R8529:Uggt1	UTSW	1	36184432	missense	possibly damaging	0.85
R8730:Uggt1	UTSW	1	36197543	critical splice donor site	probably null
R8917:Uggt1	UTSW	1	36146654	missense
R8947:Uggt1	UTSW	1	36158148	missense	probably benign	0.12
R9240:Uggt1	UTSW	1	36182615	missense	possibly damaging	0.50
R9248:Uggt1	UTSW	1	36210022	missense	possibly damaging	0.80
R9401:Uggt1	UTSW	1	36216131	critical splice donor site	probably null
R9414:Uggt1	UTSW	1	36184426	missense	probably benign	0.01
R9416:Uggt1	UTSW	1	36164522	missense
R9441:Uggt1	UTSW	1	36221225	missense	probably benign	0.02
R9489:Uggt1	UTSW	1	36234805	critical splice donor site	probably null
R9563:Uggt1	UTSW	1	36165546	missense	possibly damaging	0.60
R9605:Uggt1	UTSW	1	36234805	critical splice donor site	probably null
X0022:Uggt1	UTSW	1	36165555	missense	possibly damaging	0.67
Z1088:Uggt1	UTSW	1	36174191	missense	probably damaging	1.00
Z1176:Uggt1	UTSW	1	36161695	missense	probably damaging	1.00
Z1177:Uggt1	UTSW	1	36155073	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGCTTCCTAAGCTAAGGGGAGAC -3'
(R):5'- ACCAGATGTTGCTGTGCCTGAG -3'

Sequencing Primer
(F):5'- GCAAGGACTGTTAGTTTGCTACAAC -3'
(R):5'- GTAGTCCTGACTATGATCTCCAGTG -3'

Posted On

2013-10-16