Incidental Mutation 'R0827:Tnnt2'
ID78274
Institutional Source Beutler Lab
Gene Symbol Tnnt2
Ensembl Gene ENSMUSG00000026414
Gene Nametroponin T2, cardiac
SynonymscTnT, Tnt, cardiac TnT
MMRRC Submission 039007-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0827 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location135836354-135852260 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 135843796 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027671] [ENSMUST00000112085] [ENSMUST00000112086] [ENSMUST00000112087] [ENSMUST00000178204] [ENSMUST00000178854] [ENSMUST00000179863] [ENSMUST00000188028] [ENSMUST00000189355] [ENSMUST00000189732] [ENSMUST00000189826] [ENSMUST00000190451]
Predicted Effect probably benign
Transcript: ENSMUST00000027671
SMART Domains Protein: ENSMUSP00000027671
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Pfam:Troponin 96 234 1e-33 PFAM
Pfam:Troponin 226 289 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112085
SMART Domains Protein: ENSMUSP00000107715
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 20 54 N/A INTRINSIC
Pfam:Troponin 100 238 2.4e-33 PFAM
Pfam:Troponin 230 293 2.7e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000112086
AA Change: S21G
SMART Domains Protein: ENSMUSP00000107716
Gene: ENSMUSG00000026414
AA Change: S21G

DomainStartEndE-ValueType
low complexity region 3 58 N/A INTRINSIC
Pfam:Troponin 106 244 2.5e-33 PFAM
Pfam:Troponin 236 299 2.8e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000112087
AA Change: S21G
SMART Domains Protein: ENSMUSP00000107717
Gene: ENSMUSG00000026414
AA Change: S21G

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
Pfam:Troponin 106 250 1.1e-38 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000178204
AA Change: S25G
SMART Domains Protein: ENSMUSP00000137579
Gene: ENSMUSG00000026414
AA Change: S25G

DomainStartEndE-ValueType
coiled coil region 1 38 N/A INTRINSIC
Pfam:Troponin 110 245 3.8e-34 PFAM
Pfam:Troponin 238 300 4.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178854
SMART Domains Protein: ENSMUSP00000136265
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
Pfam:Troponin 100 244 1.7e-39 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000179863
AA Change: S25G
SMART Domains Protein: ENSMUSP00000137093
Gene: ENSMUSG00000026414
AA Change: S25G

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
Pfam:Troponin 110 251 3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186225
Predicted Effect unknown
Transcript: ENSMUST00000188028
AA Change: S25G
SMART Domains Protein: ENSMUSP00000140941
Gene: ENSMUSG00000026414
AA Change: S25G

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
Pfam:Troponin 110 251 3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189355
SMART Domains Protein: ENSMUSP00000139919
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Pfam:Troponin 96 240 1.6e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189732
SMART Domains Protein: ENSMUSP00000139669
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
Pfam:Troponin 100 244 1.7e-39 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000189826
AA Change: S25G
SMART Domains Protein: ENSMUSP00000140807
Gene: ENSMUSG00000026414
AA Change: S25G

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
Pfam:Troponin 110 201 1.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191055
Predicted Effect probably benign
Transcript: ENSMUST00000190451
SMART Domains Protein: ENSMUSP00000140282
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
PDB:2Z5H|T 85 114 3e-7 PDB
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. Transcripts for this gene undergo alternative splicing that results in many tissue-specific isoforms, however, the full-length nature of some of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during and prior to organogenesis and abnormal heart development. Mice homozygous for an allele that lacks the lysine residue at position 210 exhibit dilated cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,671 S1397P probably benign Het
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ankk1 A G 9: 49,421,737 I149T possibly damaging Het
Ankrd63 A G 2: 118,702,553 S296P possibly damaging Het
Arpc1b T G 5: 145,125,756 C227G probably benign Het
B4gat1 A G 19: 5,039,697 R241G possibly damaging Het
Ccar2 T C 14: 70,139,838 N751D probably benign Het
Cd55b T C 1: 130,414,236 I221M probably damaging Het
Cntn5 A G 9: 9,666,938 V1032A possibly damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Colec10 G A 15: 54,462,584 C270Y probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cyp2j12 T G 4: 96,112,862 probably benign Het
Dennd5a G A 7: 109,899,731 T999M probably damaging Het
Dusp13 C A 14: 21,742,771 V29L probably benign Het
Efr3a A C 15: 65,853,551 D83A possibly damaging Het
Elmod2 A G 8: 83,316,795 probably null Het
Eml3 C A 19: 8,938,466 T640K probably damaging Het
Eps8l1 T C 7: 4,477,389 V543A possibly damaging Het
Ermn T C 2: 58,048,251 K117E probably damaging Het
F830045P16Rik A G 2: 129,472,776 S194P probably benign Het
Faim2 A G 15: 99,524,736 V60A probably benign Het
Fancd2 G A 6: 113,586,249 probably null Het
Fbxo43 A T 15: 36,162,969 S31T possibly damaging Het
Gab2 G A 7: 97,300,332 R411Q probably damaging Het
Gm17727 A T 9: 35,777,851 L12Q probably damaging Het
Gpm6a A T 8: 55,058,883 D264V probably damaging Het
Hist1h1t A G 13: 23,696,221 D119G probably benign Het
Hsp90aa1 T C 12: 110,692,695 E556G probably benign Het
Ifi203 A T 1: 173,928,463 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnc3 A G 7: 44,595,206 T307A probably damaging Het
Kin C A 2: 10,090,376 probably benign Het
Knl1 T C 2: 119,088,901 probably benign Het
Lrp4 G A 2: 91,495,041 V1404M probably damaging Het
Lrrc71 T A 3: 87,742,645 probably null Het
Med13l T C 5: 118,726,247 probably benign Het
Mfap5 A G 6: 122,520,920 D39G probably damaging Het
Mlxipl T C 5: 135,132,738 S504P probably benign Het
Myo3a T G 2: 22,558,215 Y1D probably damaging Het
Nek1 A G 8: 61,105,648 probably benign Het
Nfkbiz T C 16: 55,816,367 R524G probably damaging Het
Npbwr1 T C 1: 5,916,789 T169A possibly damaging Het
Nuggc T C 14: 65,608,891 Y84H probably damaging Het
Nxph3 G A 11: 95,511,426 S54L probably benign Het
Olfr311 T C 11: 58,841,771 I219T probably damaging Het
Olfr532 A G 7: 140,419,467 F102S probably damaging Het
Ostn A G 16: 27,324,631 N70D probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pnpla6 A T 8: 3,517,618 M109L possibly damaging Het
Ppil6 T A 10: 41,494,504 probably benign Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Ptprd A T 4: 76,128,915 D371E probably damaging Het
Ripor2 T A 13: 24,694,186 F315I probably damaging Het
Rmi2 G A 16: 10,835,240 G51S probably damaging Het
Scg3 A G 9: 75,683,697 I10T possibly damaging Het
Scn9a T A 2: 66,536,124 K761* probably null Het
Scyl2 A G 10: 89,657,865 L347P possibly damaging Het
Sh3d21 A G 4: 126,152,271 probably benign Het
Shc1 T A 3: 89,426,783 probably null Het
Slbp A G 5: 33,643,822 S182P probably damaging Het
Slc24a1 C T 9: 64,928,190 G885D probably benign Het
Slc24a3 T C 2: 145,518,492 probably benign Het
Sowahb T G 5: 93,043,286 N525H probably damaging Het
Sppl3 T A 5: 115,082,333 C101* probably null Het
Srsf5 A G 12: 80,949,540 K163E probably damaging Het
Sult2a4 A G 7: 13,984,961 I119T probably benign Het
Svep1 A G 4: 58,053,113 probably benign Het
Tas1r3 G A 4: 155,860,869 R632W probably benign Het
Tlr4 T A 4: 66,833,880 probably null Het
Tmf1 A C 6: 97,158,050 L1001* probably null Het
Trank1 G A 9: 111,349,417 probably benign Het
Trdn A T 10: 33,399,158 probably benign Het
Trmt6 A T 2: 132,815,834 V34E probably damaging Het
Trrap T C 5: 144,814,830 F1699L probably benign Het
Ttk A G 9: 83,843,915 R250G probably benign Het
Ttn T A 2: 76,809,904 I13787F probably damaging Het
Uggt1 T A 1: 36,156,313 probably null Het
Ugt2b35 T A 5: 87,008,130 probably benign Het
Ugt2b36 C A 5: 87,066,375 R470L possibly damaging Het
Unk A G 11: 116,053,109 D352G possibly damaging Het
Vmn2r77 G T 7: 86,802,016 C370F probably damaging Het
Vmn2r85 A G 10: 130,429,518 I32T possibly damaging Het
Zfp637 A G 6: 117,845,444 I178V possibly damaging Het
Zfp943 A G 17: 21,992,090 probably null Het
Zyg11a A G 4: 108,210,042 probably benign Het
Other mutations in Tnnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Tnnt2 APN 1 135851702 missense probably damaging 1.00
IGL00885:Tnnt2 APN 1 135846764 splice site probably benign
IGL02223:Tnnt2 APN 1 135842015 intron probably benign
IGL03094:Tnnt2 APN 1 135849462 critical splice donor site probably null
R1469:Tnnt2 UTSW 1 135852055 missense possibly damaging 0.83
R1469:Tnnt2 UTSW 1 135852055 missense possibly damaging 0.83
R1478:Tnnt2 UTSW 1 135848026 missense probably benign 0.40
R1728:Tnnt2 UTSW 1 135845506 intron probably benign
R1729:Tnnt2 UTSW 1 135845506 intron probably benign
R1730:Tnnt2 UTSW 1 135845506 intron probably benign
R1739:Tnnt2 UTSW 1 135845506 intron probably benign
R1762:Tnnt2 UTSW 1 135845506 intron probably benign
R1783:Tnnt2 UTSW 1 135845506 intron probably benign
R1784:Tnnt2 UTSW 1 135845506 intron probably benign
R1785:Tnnt2 UTSW 1 135845506 intron probably benign
R1891:Tnnt2 UTSW 1 135840859 critical splice acceptor site probably null
R2049:Tnnt2 UTSW 1 135846761 splice site probably benign
R2104:Tnnt2 UTSW 1 135843809 intron probably benign
R2130:Tnnt2 UTSW 1 135846761 splice site probably benign
R2141:Tnnt2 UTSW 1 135846761 splice site probably benign
R2225:Tnnt2 UTSW 1 135843791 intron probably benign
R2227:Tnnt2 UTSW 1 135843791 intron probably benign
R2504:Tnnt2 UTSW 1 135852065 missense probably damaging 0.96
R4883:Tnnt2 UTSW 1 135847758 nonsense probably null
R5963:Tnnt2 UTSW 1 135843862 intron probably benign
R6082:Tnnt2 UTSW 1 135849434 missense probably benign 0.30
R6261:Tnnt2 UTSW 1 135850554 intron probably null
R7208:Tnnt2 UTSW 1 135850376 splice site probably null
R7241:Tnnt2 UTSW 1 135851706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAGGAGTGAGGCTGCCATATTG -3'
(R):5'- GTCCCCACATGAACACTGACATGAG -3'

Sequencing Primer
(F):5'- AGGCTGCCATATTGCTTGAATG -3'
(R):5'- GGTTTGTTCCTATCACAGGAATCC -3'
Posted On2013-10-16