Mutagenetix > Incidental Mutations

Incidental Mutation 'R0827:Myo3a'

78277

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

MMRRC Submission

039007-MU

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0827 (G1)

Quality Score

208

Status

Validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 22558215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Aspartic acid at position 1 (Y1D)

Ref Sequence

ENSEMBL: ENSMUSP00000116185 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000138863]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000044749
AA Change: Y939D

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: Y939D

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000138863
AA Change: Y1D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116185
Gene: ENSMUSG00000025716
AA Change: Y1D

Domain	Start	End	E-Value	Type
Pfam:Myosin_head	1	110	1.7e-28	PFAM
IQ	123	145	2.88e1	SMART
IQ	150	172	9.48e-3	SMART
low complexity region	215	231	N/A	INTRINSIC
low complexity region	421	431	N/A	INTRINSIC
low complexity region	558	567	N/A	INTRINSIC

Meta Mutation Damage Score

0.4245

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 93.6%

Validation Efficiency

100% (88/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	C	7: 79,099,671	S1397P	probably benign	Het
Adamts15	T	C	9: 30,921,480	Y253C	probably damaging	Het
Ankk1	A	G	9: 49,421,737	I149T	possibly damaging	Het
Ankrd63	A	G	2: 118,702,553	S296P	possibly damaging	Het
Arpc1b	T	G	5: 145,125,756	C227G	probably benign	Het
B4gat1	A	G	19: 5,039,697	R241G	possibly damaging	Het
Ccar2	T	C	14: 70,139,838	N751D	probably benign	Het
Cd55b	T	C	1: 130,414,236	I221M	probably damaging	Het
Cntn5	A	G	9: 9,666,938	V1032A	possibly damaging	Het
Col11a1	G	A	3: 114,138,765	R113H	unknown	Het
Colec10	G	A	15: 54,462,584	C270Y	probably damaging	Het
Ctnnbl1	C	T	2: 157,799,417		probably benign	Het
Cyp2j12	T	G	4: 96,112,862		probably benign	Het
Dennd5a	G	A	7: 109,899,731	T999M	probably damaging	Het
Dusp13	C	A	14: 21,742,771	V29L	probably benign	Het
Efr3a	A	C	15: 65,853,551	D83A	possibly damaging	Het
Elmod2	A	G	8: 83,316,795		probably null	Het
Eml3	C	A	19: 8,938,466	T640K	probably damaging	Het
Eps8l1	T	C	7: 4,477,389	V543A	possibly damaging	Het
Ermn	T	C	2: 58,048,251	K117E	probably damaging	Het
F830045P16Rik	A	G	2: 129,472,776	S194P	probably benign	Het
Faim2	A	G	15: 99,524,736	V60A	probably benign	Het
Fancd2	G	A	6: 113,586,249		probably null	Het
Fbxo43	A	T	15: 36,162,969	S31T	possibly damaging	Het
Gab2	G	A	7: 97,300,332	R411Q	probably damaging	Het
Gm17727	A	T	9: 35,777,851	L12Q	probably damaging	Het
Gpm6a	A	T	8: 55,058,883	D264V	probably damaging	Het
Hist1h1t	A	G	13: 23,696,221	D119G	probably benign	Het
Hsp90aa1	T	C	12: 110,692,695	E556G	probably benign	Het
Ifi203	A	T	1: 173,928,463		probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Kcnc3	A	G	7: 44,595,206	T307A	probably damaging	Het
Kin	C	A	2: 10,090,376		probably benign	Het
Knl1	T	C	2: 119,088,901		probably benign	Het
Lrp4	G	A	2: 91,495,041	V1404M	probably damaging	Het
Lrrc71	T	A	3: 87,742,645		probably null	Het
Med13l	T	C	5: 118,726,247		probably benign	Het
Mfap5	A	G	6: 122,520,920	D39G	probably damaging	Het
Mlxipl	T	C	5: 135,132,738	S504P	probably benign	Het
Nek1	A	G	8: 61,105,648		probably benign	Het
Nfkbiz	T	C	16: 55,816,367	R524G	probably damaging	Het
Npbwr1	T	C	1: 5,916,789	T169A	possibly damaging	Het
Nuggc	T	C	14: 65,608,891	Y84H	probably damaging	Het
Nxph3	G	A	11: 95,511,426	S54L	probably benign	Het
Olfr311	T	C	11: 58,841,771	I219T	probably damaging	Het
Olfr532	A	G	7: 140,419,467	F102S	probably damaging	Het
Ostn	A	G	16: 27,324,631	N70D	probably damaging	Het
Pcdhb2	G	A	18: 37,295,657	V228I	possibly damaging	Het
Pnpla6	A	T	8: 3,517,618	M109L	possibly damaging	Het
Ppil6	T	A	10: 41,494,504		probably benign	Het
Prss46	A	G	9: 110,851,432	N215S	probably benign	Het
Ptprd	A	T	4: 76,128,915	D371E	probably damaging	Het
Ripor2	T	A	13: 24,694,186	F315I	probably damaging	Het
Rmi2	G	A	16: 10,835,240	G51S	probably damaging	Het
Scg3	A	G	9: 75,683,697	I10T	possibly damaging	Het
Scn9a	T	A	2: 66,536,124	K761*	probably null	Het
Scyl2	A	G	10: 89,657,865	L347P	possibly damaging	Het
Sh3d21	A	G	4: 126,152,271		probably benign	Het
Shc1	T	A	3: 89,426,783		probably null	Het
Slbp	A	G	5: 33,643,822	S182P	probably damaging	Het
Slc24a1	C	T	9: 64,928,190	G885D	probably benign	Het
Slc24a3	T	C	2: 145,518,492		probably benign	Het
Sowahb	T	G	5: 93,043,286	N525H	probably damaging	Het
Sppl3	T	A	5: 115,082,333	C101*	probably null	Het
Srsf5	A	G	12: 80,949,540	K163E	probably damaging	Het
Sult2a4	A	G	7: 13,984,961	I119T	probably benign	Het
Svep1	A	G	4: 58,053,113		probably benign	Het
Tas1r3	G	A	4: 155,860,869	R632W	probably benign	Het
Tlr4	T	A	4: 66,833,880		probably null	Het
Tmf1	A	C	6: 97,158,050	L1001*	probably null	Het
Tnnt2	A	G	1: 135,843,796		probably benign	Het
Trank1	G	A	9: 111,349,417		probably benign	Het
Trdn	A	T	10: 33,399,158		probably benign	Het
Trmt6	A	T	2: 132,815,834	V34E	probably damaging	Het
Trrap	T	C	5: 144,814,830	F1699L	probably benign	Het
Ttk	A	G	9: 83,843,915	R250G	probably benign	Het
Ttn	T	A	2: 76,809,904	I13787F	probably damaging	Het
Uggt1	T	A	1: 36,156,313		probably null	Het
Ugt2b35	T	A	5: 87,008,130		probably benign	Het
Ugt2b36	C	A	5: 87,066,375	R470L	possibly damaging	Het
Unk	A	G	11: 116,053,109	D352G	possibly damaging	Het
Vmn2r77	G	T	7: 86,802,016	C370F	probably damaging	Het
Vmn2r85	A	G	10: 130,429,518	I32T	possibly damaging	Het
Zfp637	A	G	6: 117,845,444	I178V	possibly damaging	Het
Zfp943	A	G	17: 21,992,090		probably null	Het
Zyg11a	A	G	4: 108,210,042		probably benign	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
PIT4445001:Myo3a	UTSW	2	22542415	missense	possibly damaging	0.64
R0008:Myo3a	UTSW	2	22579741	missense	probably damaging	0.99
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0594:Myo3a	UTSW	2	22544332	splice site	probably benign
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1301:Myo3a	UTSW	2	22267095	splice site	probably benign
R1352:Myo3a	UTSW	2	22323675	critical splice donor site	probably null
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1823:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1954:Myo3a	UTSW	2	22241226	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2091:Myo3a	UTSW	2	22333677	missense	probably damaging	0.99
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2126:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R3926:Myo3a	UTSW	2	22565041	missense	probably damaging	0.99
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4043:Myo3a	UTSW	2	22333539	splice site	probably benign
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6513:Myo3a	UTSW	2	22407332	missense	probably damaging	1.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7301:Myo3a	UTSW	2	22544466	critical splice donor site	probably null
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99
R8054:Myo3a	UTSW	2	22574317	missense	probably benign	0.00
R8140:Myo3a	UTSW	2	22407346	missense	probably damaging	1.00
R8143:Myo3a	UTSW	2	22282665	critical splice donor site	probably null
R8346:Myo3a	UTSW	2	22558422	critical splice donor site	probably null
R8421:Myo3a	UTSW	2	22362124	missense	probably benign	0.07
R8495:Myo3a	UTSW	2	22396273	missense	probably damaging	0.96
R8551:Myo3a	UTSW	2	22332466	missense	probably benign	0.00
R8708:Myo3a	UTSW	2	22291796	splice site	probably benign
R8757:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8759:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8779:Myo3a	UTSW	2	22245593	nonsense	probably null
R8828:Myo3a	UTSW	2	22241053	missense	probably benign	0.01
R8910:Myo3a	UTSW	2	22574268	missense	probably benign	0.01
R8916:Myo3a	UTSW	2	22567692	missense	probably damaging	1.00
R8926:Myo3a	UTSW	2	22396263	missense	possibly damaging	0.95
R9028:Myo3a	UTSW	2	22600087	missense	possibly damaging	0.79
R9046:Myo3a	UTSW	2	22558355	missense	probably damaging	0.99
R9120:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R9153:Myo3a	UTSW	2	22399933	missense	probably benign	0.02
R9191:Myo3a	UTSW	2	22579829	missense	probably benign	0.24
R9258:Myo3a	UTSW	2	22577533	missense	possibly damaging	0.60
R9436:Myo3a	UTSW	2	22407424	nonsense	probably null
R9464:Myo3a	UTSW	2	22227572	start gained	probably benign
Z1177:Myo3a	UTSW	2	22618140	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- GGCAACCTCCTAGTTATTGCCTCTACA -3'
(R):5'- GCGAAGAGTATCCGATGTGAATAACCA -3'

Sequencing Primer
(F):5'- TGCCTCTACATGTTTATCATTGAATC -3'
(R):5'- GATGTGAATAACCAAGCCTTCG -3'

Posted On

2013-10-16