Incidental Mutation 'R0827:Shc1'
ID78288
Institutional Source Beutler Lab
Gene Symbol Shc1
Ensembl Gene ENSMUSG00000042626
Gene Namesrc homology 2 domain-containing transforming protein C1
SynonymsShcA, p66shc, p66
MMRRC Submission 039007-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R0827 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89418443-89430027 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 89426783 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039110] [ENSMUST00000060061] [ENSMUST00000094378] [ENSMUST00000107413] [ENSMUST00000107417] [ENSMUST00000125036] [ENSMUST00000128238] [ENSMUST00000137793] [ENSMUST00000191485] [ENSMUST00000154791]
Predicted Effect probably null
Transcript: ENSMUST00000039110
SMART Domains Protein: ENSMUSP00000035361
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060061
SMART Domains Protein: ENSMUSP00000053672
Gene: ENSMUSG00000047824

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
Blast:SH2 52 78 1e-9 BLAST
low complexity region 115 163 N/A INTRINSIC
low complexity region 177 193 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
low complexity region 288 302 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
PHD 328 382 3.3e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000094378
SMART Domains Protein: ENSMUSP00000091940
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 16 55 N/A INTRINSIC
low complexity region 85 98 N/A INTRINSIC
low complexity region 116 127 N/A INTRINSIC
PTB 157 321 2.15e-31 SMART
SH2 482 561 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107413
SMART Domains Protein: ENSMUSP00000103036
Gene: ENSMUSG00000047824

DomainStartEndE-ValueType
Blast:SH2 15 41 1e-9 BLAST
low complexity region 78 126 N/A INTRINSIC
low complexity region 140 156 N/A INTRINSIC
low complexity region 163 177 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 251 265 N/A INTRINSIC
low complexity region 272 287 N/A INTRINSIC
PHD 291 345 3.3e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107417
SMART Domains Protein: ENSMUSP00000103040
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
PTB 2 166 2.15e-31 SMART
SH2 327 406 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125036
SMART Domains Protein: ENSMUSP00000115509
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
PTB 1 155 1.5e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125830
Predicted Effect probably benign
Transcript: ENSMUST00000128238
SMART Domains Protein: ENSMUSP00000119293
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 144 7.7e-19 PFAM
Pfam:PID 134 190 7.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136573
Predicted Effect probably benign
Transcript: ENSMUST00000137793
SMART Domains Protein: ENSMUSP00000117190
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153334
Predicted Effect probably null
Transcript: ENSMUST00000191485
SMART Domains Protein: ENSMUSP00000140336
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154791
SMART Domains Protein: ENSMUSP00000123635
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 100 5.7e-13 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes three main isoforms that differ in activities and subcellular location. While all three are adapter proteins in signal transduction pathways, the longest (p66Shc) may be involved in regulating life span and the effects of reactive oxygen species. The other two isoforms, p52Shc and p46Shc, link activated receptor tyrosine kinases to the Ras pathway by recruitment of the GRB2/SOS complex. p66Shc is not involved in Ras activation. Unlike the other two isoforms, p46Shc is targeted to the mitochondrial matrix. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygotes with a targeted mutation of the exon encoding the CH2 region show an extended life span, reduced cellular sensitivity to oxidative stress and UV irradiation, and resistance to diet-induced atherogenesis. Homozygotes lacking all three isoformsdie around E11.5 with cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,671 S1397P probably benign Het
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ankk1 A G 9: 49,421,737 I149T possibly damaging Het
Ankrd63 A G 2: 118,702,553 S296P possibly damaging Het
Arpc1b T G 5: 145,125,756 C227G probably benign Het
B4gat1 A G 19: 5,039,697 R241G possibly damaging Het
Ccar2 T C 14: 70,139,838 N751D probably benign Het
Cd55b T C 1: 130,414,236 I221M probably damaging Het
Cntn5 A G 9: 9,666,938 V1032A possibly damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Colec10 G A 15: 54,462,584 C270Y probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cyp2j12 T G 4: 96,112,862 probably benign Het
Dennd5a G A 7: 109,899,731 T999M probably damaging Het
Dusp13 C A 14: 21,742,771 V29L probably benign Het
Efr3a A C 15: 65,853,551 D83A possibly damaging Het
Elmod2 A G 8: 83,316,795 probably null Het
Eml3 C A 19: 8,938,466 T640K probably damaging Het
Eps8l1 T C 7: 4,477,389 V543A possibly damaging Het
Ermn T C 2: 58,048,251 K117E probably damaging Het
F830045P16Rik A G 2: 129,472,776 S194P probably benign Het
Faim2 A G 15: 99,524,736 V60A probably benign Het
Fancd2 G A 6: 113,586,249 probably null Het
Fbxo43 A T 15: 36,162,969 S31T possibly damaging Het
Gab2 G A 7: 97,300,332 R411Q probably damaging Het
Gm17727 A T 9: 35,777,851 L12Q probably damaging Het
Gpm6a A T 8: 55,058,883 D264V probably damaging Het
Hist1h1t A G 13: 23,696,221 D119G probably benign Het
Hsp90aa1 T C 12: 110,692,695 E556G probably benign Het
Ifi203 A T 1: 173,928,463 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnc3 A G 7: 44,595,206 T307A probably damaging Het
Kin C A 2: 10,090,376 probably benign Het
Knl1 T C 2: 119,088,901 probably benign Het
Lrp4 G A 2: 91,495,041 V1404M probably damaging Het
Lrrc71 T A 3: 87,742,645 probably null Het
Med13l T C 5: 118,726,247 probably benign Het
Mfap5 A G 6: 122,520,920 D39G probably damaging Het
Mlxipl T C 5: 135,132,738 S504P probably benign Het
Myo3a T G 2: 22,558,215 Y1D probably damaging Het
Nek1 A G 8: 61,105,648 probably benign Het
Nfkbiz T C 16: 55,816,367 R524G probably damaging Het
Npbwr1 T C 1: 5,916,789 T169A possibly damaging Het
Nuggc T C 14: 65,608,891 Y84H probably damaging Het
Nxph3 G A 11: 95,511,426 S54L probably benign Het
Olfr311 T C 11: 58,841,771 I219T probably damaging Het
Olfr532 A G 7: 140,419,467 F102S probably damaging Het
Ostn A G 16: 27,324,631 N70D probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pnpla6 A T 8: 3,517,618 M109L possibly damaging Het
Ppil6 T A 10: 41,494,504 probably benign Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Ptprd A T 4: 76,128,915 D371E probably damaging Het
Ripor2 T A 13: 24,694,186 F315I probably damaging Het
Rmi2 G A 16: 10,835,240 G51S probably damaging Het
Scg3 A G 9: 75,683,697 I10T possibly damaging Het
Scn9a T A 2: 66,536,124 K761* probably null Het
Scyl2 A G 10: 89,657,865 L347P possibly damaging Het
Sh3d21 A G 4: 126,152,271 probably benign Het
Slbp A G 5: 33,643,822 S182P probably damaging Het
Slc24a1 C T 9: 64,928,190 G885D probably benign Het
Slc24a3 T C 2: 145,518,492 probably benign Het
Sowahb T G 5: 93,043,286 N525H probably damaging Het
Sppl3 T A 5: 115,082,333 C101* probably null Het
Srsf5 A G 12: 80,949,540 K163E probably damaging Het
Sult2a4 A G 7: 13,984,961 I119T probably benign Het
Svep1 A G 4: 58,053,113 probably benign Het
Tas1r3 G A 4: 155,860,869 R632W probably benign Het
Tlr4 T A 4: 66,833,880 probably null Het
Tmf1 A C 6: 97,158,050 L1001* probably null Het
Tnnt2 A G 1: 135,843,796 probably benign Het
Trank1 G A 9: 111,349,417 probably benign Het
Trdn A T 10: 33,399,158 probably benign Het
Trmt6 A T 2: 132,815,834 V34E probably damaging Het
Trrap T C 5: 144,814,830 F1699L probably benign Het
Ttk A G 9: 83,843,915 R250G probably benign Het
Ttn T A 2: 76,809,904 I13787F probably damaging Het
Uggt1 T A 1: 36,156,313 probably null Het
Ugt2b35 T A 5: 87,008,130 probably benign Het
Ugt2b36 C A 5: 87,066,375 R470L possibly damaging Het
Unk A G 11: 116,053,109 D352G possibly damaging Het
Vmn2r77 G T 7: 86,802,016 C370F probably damaging Het
Vmn2r85 A G 10: 130,429,518 I32T possibly damaging Het
Zfp637 A G 6: 117,845,444 I178V possibly damaging Het
Zfp943 A G 17: 21,992,090 probably null Het
Zyg11a A G 4: 108,210,042 probably benign Het
Other mutations in Shc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Shc1 APN 3 89424229 missense probably damaging 0.99
IGL01608:Shc1 APN 3 89424849 missense probably damaging 0.96
IGL02710:Shc1 APN 3 89424610 splice site probably null
PIT4382001:Shc1 UTSW 3 89427408 missense probably benign 0.00
R0323:Shc1 UTSW 3 89423713 missense probably damaging 0.98
R0445:Shc1 UTSW 3 89426537 missense probably damaging 1.00
R0833:Shc1 UTSW 3 89422969 missense probably damaging 1.00
R0836:Shc1 UTSW 3 89422969 missense probably damaging 1.00
R1155:Shc1 UTSW 3 89424819 missense probably benign 0.30
R1497:Shc1 UTSW 3 89428445 makesense probably null
R1929:Shc1 UTSW 3 89423542 missense probably damaging 1.00
R2271:Shc1 UTSW 3 89423542 missense probably damaging 1.00
R4402:Shc1 UTSW 3 89426678 missense probably benign
R4965:Shc1 UTSW 3 89426996 missense probably damaging 0.98
R5898:Shc1 UTSW 3 89426967 nonsense probably null
R6198:Shc1 UTSW 3 89422107 missense probably benign
R6604:Shc1 UTSW 3 89421879 missense probably damaging 1.00
R6673:Shc1 UTSW 3 89421962 missense possibly damaging 0.93
R6705:Shc1 UTSW 3 89422959 nonsense probably null
R7379:Shc1 UTSW 3 89426822 missense probably benign 0.00
R8041:Shc1 UTSW 3 89422953 missense probably damaging 1.00
R8284:Shc1 UTSW 3 89421908 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CAGAGCTGAGCCATAGTATGTGCC -3'
(R):5'- ATCACCTGAGACCCAGACTCAGTG -3'

Sequencing Primer
(F):5'- CAGTACTACAATGACTTTCCAGGG -3'
(R):5'- CTCATGTCAAAAAGGTCTCGG -3'
Posted On2013-10-16