Incidental Mutation 'R0827:Kcnc3'
ID78312
Institutional Source Beutler Lab
Gene Symbol Kcnc3
Ensembl Gene ENSMUSG00000062785
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 3
SynonymsKcr2-3, KShIIID, Kv3.3
MMRRC Submission 039007-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0827 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44590664-44604754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44595206 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 307 (T307A)
Ref Sequence ENSEMBL: ENSMUSP00000146535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107906] [ENSMUST00000107907] [ENSMUST00000207493] [ENSMUST00000208651] [ENSMUST00000209177]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107906
AA Change: T307A

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103539
Gene: ENSMUSG00000062785
AA Change: T307A

DomainStartEndE-ValueType
Pfam:Potassium_chann 1 21 8e-9 PFAM
BTB 90 194 4.38e-12 SMART
low complexity region 211 243 N/A INTRINSIC
low complexity region 251 267 N/A INTRINSIC
Pfam:Ion_trans 290 551 4.1e-45 PFAM
Pfam:Ion_trans_2 451 544 8.2e-12 PFAM
low complexity region 578 605 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
low complexity region 750 767 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107907
AA Change: T307A

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103540
Gene: ENSMUSG00000062785
AA Change: T307A

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
BTB 90 194 4.38e-12 SMART
low complexity region 211 243 N/A INTRINSIC
low complexity region 251 267 N/A INTRINSIC
Pfam:Ion_trans 351 539 1.5e-31 PFAM
Pfam:Ion_trans_2 450 544 2.4e-11 PFAM
low complexity region 578 605 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
low complexity region 729 745 N/A INTRINSIC
low complexity region 749 766 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207493
AA Change: T307A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000207497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208412
Predicted Effect probably benign
Transcript: ENSMUST00000208651
AA Change: T307A

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209101
Predicted Effect probably damaging
Transcript: ENSMUST00000209177
AA Change: T307A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.1832 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. Alternate splicing results in several transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozgous null mice show no overt phenotype, though mutation of this locus in conjunction with mutations in another potassium channel results in alcohol hypersensitivty, increased locomotion, and spontaneous myoclonus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,671 S1397P probably benign Het
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ankk1 A G 9: 49,421,737 I149T possibly damaging Het
Ankrd63 A G 2: 118,702,553 S296P possibly damaging Het
Arpc1b T G 5: 145,125,756 C227G probably benign Het
B4gat1 A G 19: 5,039,697 R241G possibly damaging Het
Ccar2 T C 14: 70,139,838 N751D probably benign Het
Cd55b T C 1: 130,414,236 I221M probably damaging Het
Cntn5 A G 9: 9,666,938 V1032A possibly damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Colec10 G A 15: 54,462,584 C270Y probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cyp2j12 T G 4: 96,112,862 probably benign Het
Dennd5a G A 7: 109,899,731 T999M probably damaging Het
Dusp13 C A 14: 21,742,771 V29L probably benign Het
Efr3a A C 15: 65,853,551 D83A possibly damaging Het
Elmod2 A G 8: 83,316,795 probably null Het
Eml3 C A 19: 8,938,466 T640K probably damaging Het
Eps8l1 T C 7: 4,477,389 V543A possibly damaging Het
Ermn T C 2: 58,048,251 K117E probably damaging Het
F830045P16Rik A G 2: 129,472,776 S194P probably benign Het
Faim2 A G 15: 99,524,736 V60A probably benign Het
Fancd2 G A 6: 113,586,249 probably null Het
Fbxo43 A T 15: 36,162,969 S31T possibly damaging Het
Gab2 G A 7: 97,300,332 R411Q probably damaging Het
Gm17727 A T 9: 35,777,851 L12Q probably damaging Het
Gpm6a A T 8: 55,058,883 D264V probably damaging Het
Hist1h1t A G 13: 23,696,221 D119G probably benign Het
Hsp90aa1 T C 12: 110,692,695 E556G probably benign Het
Ifi203 A T 1: 173,928,463 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kin C A 2: 10,090,376 probably benign Het
Knl1 T C 2: 119,088,901 probably benign Het
Lrp4 G A 2: 91,495,041 V1404M probably damaging Het
Lrrc71 T A 3: 87,742,645 probably null Het
Med13l T C 5: 118,726,247 probably benign Het
Mfap5 A G 6: 122,520,920 D39G probably damaging Het
Mlxipl T C 5: 135,132,738 S504P probably benign Het
Myo3a T G 2: 22,558,215 Y1D probably damaging Het
Nek1 A G 8: 61,105,648 probably benign Het
Nfkbiz T C 16: 55,816,367 R524G probably damaging Het
Npbwr1 T C 1: 5,916,789 T169A possibly damaging Het
Nuggc T C 14: 65,608,891 Y84H probably damaging Het
Nxph3 G A 11: 95,511,426 S54L probably benign Het
Olfr311 T C 11: 58,841,771 I219T probably damaging Het
Olfr532 A G 7: 140,419,467 F102S probably damaging Het
Ostn A G 16: 27,324,631 N70D probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pnpla6 A T 8: 3,517,618 M109L possibly damaging Het
Ppil6 T A 10: 41,494,504 probably benign Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Ptprd A T 4: 76,128,915 D371E probably damaging Het
Ripor2 T A 13: 24,694,186 F315I probably damaging Het
Rmi2 G A 16: 10,835,240 G51S probably damaging Het
Scg3 A G 9: 75,683,697 I10T possibly damaging Het
Scn9a T A 2: 66,536,124 K761* probably null Het
Scyl2 A G 10: 89,657,865 L347P possibly damaging Het
Sh3d21 A G 4: 126,152,271 probably benign Het
Shc1 T A 3: 89,426,783 probably null Het
Slbp A G 5: 33,643,822 S182P probably damaging Het
Slc24a1 C T 9: 64,928,190 G885D probably benign Het
Slc24a3 T C 2: 145,518,492 probably benign Het
Sowahb T G 5: 93,043,286 N525H probably damaging Het
Sppl3 T A 5: 115,082,333 C101* probably null Het
Srsf5 A G 12: 80,949,540 K163E probably damaging Het
Sult2a4 A G 7: 13,984,961 I119T probably benign Het
Svep1 A G 4: 58,053,113 probably benign Het
Tas1r3 G A 4: 155,860,869 R632W probably benign Het
Tlr4 T A 4: 66,833,880 probably null Het
Tmf1 A C 6: 97,158,050 L1001* probably null Het
Tnnt2 A G 1: 135,843,796 probably benign Het
Trank1 G A 9: 111,349,417 probably benign Het
Trdn A T 10: 33,399,158 probably benign Het
Trmt6 A T 2: 132,815,834 V34E probably damaging Het
Trrap T C 5: 144,814,830 F1699L probably benign Het
Ttk A G 9: 83,843,915 R250G probably benign Het
Ttn T A 2: 76,809,904 I13787F probably damaging Het
Uggt1 T A 1: 36,156,313 probably null Het
Ugt2b35 T A 5: 87,008,130 probably benign Het
Ugt2b36 C A 5: 87,066,375 R470L possibly damaging Het
Unk A G 11: 116,053,109 D352G possibly damaging Het
Vmn2r77 G T 7: 86,802,016 C370F probably damaging Het
Vmn2r85 A G 10: 130,429,518 I32T possibly damaging Het
Zfp637 A G 6: 117,845,444 I178V possibly damaging Het
Zfp943 A G 17: 21,992,090 probably null Het
Zyg11a A G 4: 108,210,042 probably benign Het
Other mutations in Kcnc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Kcnc3 APN 7 44595386 missense probably damaging 1.00
IGL01607:Kcnc3 APN 7 44591304 missense probably damaging 1.00
IGL02397:Kcnc3 APN 7 44595794 missense probably damaging 1.00
IGL02807:Kcnc3 APN 7 44595957 missense probably damaging 1.00
IGL02961:Kcnc3 APN 7 44591492 missense probably damaging 0.99
elfen UTSW 7 44591296 frame shift probably null
Le_fitness UTSW 7 44595182 missense possibly damaging 0.92
Svelte UTSW 7 44595816 missense probably damaging 1.00
Trim UTSW 7 44595603 missense probably damaging 1.00
R0514:Kcnc3 UTSW 7 44595928 nonsense probably null
R1514:Kcnc3 UTSW 7 44595603 missense probably damaging 1.00
R2875:Kcnc3 UTSW 7 44591537 nonsense probably null
R4597:Kcnc3 UTSW 7 44595816 missense probably damaging 1.00
R4954:Kcnc3 UTSW 7 44591296 frame shift probably null
R4955:Kcnc3 UTSW 7 44591296 frame shift probably null
R6012:Kcnc3 UTSW 7 44598872 missense probably benign 0.26
R6093:Kcnc3 UTSW 7 44591508 missense probably benign 0.44
R6488:Kcnc3 UTSW 7 44595182 missense possibly damaging 0.92
R7542:Kcnc3 UTSW 7 44595714 missense possibly damaging 0.84
R7595:Kcnc3 UTSW 7 44591469 missense probably damaging 1.00
R7909:Kcnc3 UTSW 7 44595687 missense probably damaging 1.00
R7946:Kcnc3 UTSW 7 44596145 missense probably benign 0.13
Z1177:Kcnc3 UTSW 7 44596106 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCTGTTCCTGTCTCAGAACTG -3'
(R):5'- GGTGACCCGCATGAGAAACTCAAAG -3'

Sequencing Primer
(F):5'- CTGTCTCAGAACTGATTGCTAGAAG -3'
(R):5'- CATGAGAAACTCAAAGGTGAACC -3'
Posted On2013-10-16