Incidental Mutation 'R0827:Acan'
ID78313
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Nameaggrecan
SynonymsAgc1, b2b183Clo, Cspg1
MMRRC Submission 039007-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0827 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79053483-79115099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79099671 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1397 (S1397P)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
Predicted Effect probably benign
Transcript: ENSMUST00000032835
AA Change: S1397P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: S1397P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206779
Meta Mutation Damage Score 0.0844 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ankk1 A G 9: 49,421,737 I149T possibly damaging Het
Ankrd63 A G 2: 118,702,553 S296P possibly damaging Het
Arpc1b T G 5: 145,125,756 C227G probably benign Het
B4gat1 A G 19: 5,039,697 R241G possibly damaging Het
Ccar2 T C 14: 70,139,838 N751D probably benign Het
Cd55b T C 1: 130,414,236 I221M probably damaging Het
Cntn5 A G 9: 9,666,938 V1032A possibly damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Colec10 G A 15: 54,462,584 C270Y probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cyp2j12 T G 4: 96,112,862 probably benign Het
Dennd5a G A 7: 109,899,731 T999M probably damaging Het
Dusp13 C A 14: 21,742,771 V29L probably benign Het
Efr3a A C 15: 65,853,551 D83A possibly damaging Het
Elmod2 A G 8: 83,316,795 probably null Het
Eml3 C A 19: 8,938,466 T640K probably damaging Het
Eps8l1 T C 7: 4,477,389 V543A possibly damaging Het
Ermn T C 2: 58,048,251 K117E probably damaging Het
F830045P16Rik A G 2: 129,472,776 S194P probably benign Het
Faim2 A G 15: 99,524,736 V60A probably benign Het
Fancd2 G A 6: 113,586,249 probably null Het
Fbxo43 A T 15: 36,162,969 S31T possibly damaging Het
Gab2 G A 7: 97,300,332 R411Q probably damaging Het
Gm17727 A T 9: 35,777,851 L12Q probably damaging Het
Gpm6a A T 8: 55,058,883 D264V probably damaging Het
Hist1h1t A G 13: 23,696,221 D119G probably benign Het
Hsp90aa1 T C 12: 110,692,695 E556G probably benign Het
Ifi203 A T 1: 173,928,463 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnc3 A G 7: 44,595,206 T307A probably damaging Het
Kin C A 2: 10,090,376 probably benign Het
Knl1 T C 2: 119,088,901 probably benign Het
Lrp4 G A 2: 91,495,041 V1404M probably damaging Het
Lrrc71 T A 3: 87,742,645 probably null Het
Med13l T C 5: 118,726,247 probably benign Het
Mfap5 A G 6: 122,520,920 D39G probably damaging Het
Mlxipl T C 5: 135,132,738 S504P probably benign Het
Myo3a T G 2: 22,558,215 Y1D probably damaging Het
Nek1 A G 8: 61,105,648 probably benign Het
Nfkbiz T C 16: 55,816,367 R524G probably damaging Het
Npbwr1 T C 1: 5,916,789 T169A possibly damaging Het
Nuggc T C 14: 65,608,891 Y84H probably damaging Het
Nxph3 G A 11: 95,511,426 S54L probably benign Het
Olfr311 T C 11: 58,841,771 I219T probably damaging Het
Olfr532 A G 7: 140,419,467 F102S probably damaging Het
Ostn A G 16: 27,324,631 N70D probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pnpla6 A T 8: 3,517,618 M109L possibly damaging Het
Ppil6 T A 10: 41,494,504 probably benign Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Ptprd A T 4: 76,128,915 D371E probably damaging Het
Ripor2 T A 13: 24,694,186 F315I probably damaging Het
Rmi2 G A 16: 10,835,240 G51S probably damaging Het
Scg3 A G 9: 75,683,697 I10T possibly damaging Het
Scn9a T A 2: 66,536,124 K761* probably null Het
Scyl2 A G 10: 89,657,865 L347P possibly damaging Het
Sh3d21 A G 4: 126,152,271 probably benign Het
Shc1 T A 3: 89,426,783 probably null Het
Slbp A G 5: 33,643,822 S182P probably damaging Het
Slc24a1 C T 9: 64,928,190 G885D probably benign Het
Slc24a3 T C 2: 145,518,492 probably benign Het
Sowahb T G 5: 93,043,286 N525H probably damaging Het
Sppl3 T A 5: 115,082,333 C101* probably null Het
Srsf5 A G 12: 80,949,540 K163E probably damaging Het
Sult2a4 A G 7: 13,984,961 I119T probably benign Het
Svep1 A G 4: 58,053,113 probably benign Het
Tas1r3 G A 4: 155,860,869 R632W probably benign Het
Tlr4 T A 4: 66,833,880 probably null Het
Tmf1 A C 6: 97,158,050 L1001* probably null Het
Tnnt2 A G 1: 135,843,796 probably benign Het
Trank1 G A 9: 111,349,417 probably benign Het
Trdn A T 10: 33,399,158 probably benign Het
Trmt6 A T 2: 132,815,834 V34E probably damaging Het
Trrap T C 5: 144,814,830 F1699L probably benign Het
Ttk A G 9: 83,843,915 R250G probably benign Het
Ttn T A 2: 76,809,904 I13787F probably damaging Het
Uggt1 T A 1: 36,156,313 probably null Het
Ugt2b35 T A 5: 87,008,130 probably benign Het
Ugt2b36 C A 5: 87,066,375 R470L possibly damaging Het
Unk A G 11: 116,053,109 D352G possibly damaging Het
Vmn2r77 G T 7: 86,802,016 C370F probably damaging Het
Vmn2r85 A G 10: 130,429,518 I32T possibly damaging Het
Zfp637 A G 6: 117,845,444 I178V possibly damaging Het
Zfp943 A G 17: 21,992,090 probably null Het
Zyg11a A G 4: 108,210,042 probably benign Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Hollowleg UTSW 7 79098348 nonsense probably null
Sublimate UTSW 7 79111320 missense probably damaging 0.97
Vacuo UTSW 7 79088307 critical splice donor site probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4004:Acan UTSW 7 79100687 missense probably damaging 1.00
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4742:Acan UTSW 7 79100769 missense probably benign 0.41
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5414:Acan UTSW 7 79100988 missense probably benign 0.00
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5758:Acan UTSW 7 79101214 missense possibly damaging 0.67
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7041:Acan UTSW 7 79098348 nonsense probably null
R7193:Acan UTSW 7 79086342 missense probably damaging 1.00
R7220:Acan UTSW 7 79108148 missense
R7263:Acan UTSW 7 79092318 missense probably damaging 0.98
R7376:Acan UTSW 7 79088307 critical splice donor site probably null
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7571:Acan UTSW 7 79086267 missense probably damaging 1.00
R7709:Acan UTSW 7 79089608 missense probably damaging 1.00
R7835:Acan UTSW 7 79099875 missense probably benign 0.08
R8051:Acan UTSW 7 79100779 missense probably damaging 0.96
R8131:Acan UTSW 7 79091338 missense possibly damaging 0.92
R8138:Acan UTSW 7 79098427 missense probably benign 0.12
RF008:Acan UTSW 7 79092400 missense possibly damaging 0.83
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Z1176:Acan UTSW 7 79111354 missense probably benign
Z1177:Acan UTSW 7 79094170 missense probably damaging 0.96
Z1177:Acan UTSW 7 79100137 missense probably damaging 0.99
Z1177:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTCTCCCTTCAGGAACTGAACTC -3'
(R):5'- GTAATGCCAGAAGACTCTCCACTGC -3'

Sequencing Primer
(F):5'- CCTTCAGGAACTGAACTCAGTGG -3'
(R):5'- AAGACTCTCCACTGCCACTTATG -3'
Posted On2013-10-16