Incidental Mutation 'R0827:Dennd5a'
ID78316
Institutional Source Beutler Lab
Gene Symbol Dennd5a
Ensembl Gene ENSMUSG00000035901
Gene NameDENN/MADD domain containing 5A
Synonyms1500012B19Rik, Rab6ip1, ORF37
MMRRC Submission 039007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R0827 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location109893780-109960470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109899731 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 999 (T999M)
Ref Sequence ENSEMBL: ENSMUSP00000079295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080437] [ENSMUST00000106722]
PDB Structure
Strucure of RAB6(GTP)-R6IP1 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000080437
AA Change: T999M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079295
Gene: ENSMUSG00000035901
AA Change: T999M

DomainStartEndE-ValueType
uDENN 12 138 7.71e-45 SMART
DENN 202 390 9.28e-80 SMART
dDENN 512 588 4.06e-21 SMART
low complexity region 832 844 N/A INTRINSIC
RUN 884 947 4.9e-22 SMART
Pfam:PLAT 956 1062 1e-15 PFAM
RUN 1218 1278 3.69e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106722
AA Change: T975M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102333
Gene: ENSMUSG00000035901
AA Change: T975M

DomainStartEndE-ValueType
uDENN 12 114 2.32e-39 SMART
DENN 178 366 9.28e-80 SMART
dDENN 488 564 4.06e-21 SMART
low complexity region 808 820 N/A INTRINSIC
RUN 860 923 4.9e-22 SMART
Pfam:PLAT 932 1038 2.8e-18 PFAM
RUN 1194 1254 3.69e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156858
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN-domain-containing protein that functions as a RAB-activating guanine nucleotide exchange factor (GEF). This protein catalyzes the conversion of GDP to GTP and thereby converts inactive GDP-bound Rab proteins into their active GTP-bound form. The encoded protein is recruited by RAB6 onto Golgi membranes and is therefore referred to as RAB6-interacting protein 1. This protein binds with RAB39 as well. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene are associated with early infantile epileptic encephalopathy-49. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,671 S1397P probably benign Het
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ankk1 A G 9: 49,421,737 I149T possibly damaging Het
Ankrd63 A G 2: 118,702,553 S296P possibly damaging Het
Arpc1b T G 5: 145,125,756 C227G probably benign Het
B4gat1 A G 19: 5,039,697 R241G possibly damaging Het
Ccar2 T C 14: 70,139,838 N751D probably benign Het
Cd55b T C 1: 130,414,236 I221M probably damaging Het
Cntn5 A G 9: 9,666,938 V1032A possibly damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Colec10 G A 15: 54,462,584 C270Y probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cyp2j12 T G 4: 96,112,862 probably benign Het
Dusp13 C A 14: 21,742,771 V29L probably benign Het
Efr3a A C 15: 65,853,551 D83A possibly damaging Het
Elmod2 A G 8: 83,316,795 probably null Het
Eml3 C A 19: 8,938,466 T640K probably damaging Het
Eps8l1 T C 7: 4,477,389 V543A possibly damaging Het
Ermn T C 2: 58,048,251 K117E probably damaging Het
F830045P16Rik A G 2: 129,472,776 S194P probably benign Het
Faim2 A G 15: 99,524,736 V60A probably benign Het
Fancd2 G A 6: 113,586,249 probably null Het
Fbxo43 A T 15: 36,162,969 S31T possibly damaging Het
Gab2 G A 7: 97,300,332 R411Q probably damaging Het
Gm17727 A T 9: 35,777,851 L12Q probably damaging Het
Gpm6a A T 8: 55,058,883 D264V probably damaging Het
Hist1h1t A G 13: 23,696,221 D119G probably benign Het
Hsp90aa1 T C 12: 110,692,695 E556G probably benign Het
Ifi203 A T 1: 173,928,463 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnc3 A G 7: 44,595,206 T307A probably damaging Het
Kin C A 2: 10,090,376 probably benign Het
Knl1 T C 2: 119,088,901 probably benign Het
Lrp4 G A 2: 91,495,041 V1404M probably damaging Het
Lrrc71 T A 3: 87,742,645 probably null Het
Med13l T C 5: 118,726,247 probably benign Het
Mfap5 A G 6: 122,520,920 D39G probably damaging Het
Mlxipl T C 5: 135,132,738 S504P probably benign Het
Myo3a T G 2: 22,558,215 Y1D probably damaging Het
Nek1 A G 8: 61,105,648 probably benign Het
Nfkbiz T C 16: 55,816,367 R524G probably damaging Het
Npbwr1 T C 1: 5,916,789 T169A possibly damaging Het
Nuggc T C 14: 65,608,891 Y84H probably damaging Het
Nxph3 G A 11: 95,511,426 S54L probably benign Het
Olfr311 T C 11: 58,841,771 I219T probably damaging Het
Olfr532 A G 7: 140,419,467 F102S probably damaging Het
Ostn A G 16: 27,324,631 N70D probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pnpla6 A T 8: 3,517,618 M109L possibly damaging Het
Ppil6 T A 10: 41,494,504 probably benign Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Ptprd A T 4: 76,128,915 D371E probably damaging Het
Ripor2 T A 13: 24,694,186 F315I probably damaging Het
Rmi2 G A 16: 10,835,240 G51S probably damaging Het
Scg3 A G 9: 75,683,697 I10T possibly damaging Het
Scn9a T A 2: 66,536,124 K761* probably null Het
Scyl2 A G 10: 89,657,865 L347P possibly damaging Het
Sh3d21 A G 4: 126,152,271 probably benign Het
Shc1 T A 3: 89,426,783 probably null Het
Slbp A G 5: 33,643,822 S182P probably damaging Het
Slc24a1 C T 9: 64,928,190 G885D probably benign Het
Slc24a3 T C 2: 145,518,492 probably benign Het
Sowahb T G 5: 93,043,286 N525H probably damaging Het
Sppl3 T A 5: 115,082,333 C101* probably null Het
Srsf5 A G 12: 80,949,540 K163E probably damaging Het
Sult2a4 A G 7: 13,984,961 I119T probably benign Het
Svep1 A G 4: 58,053,113 probably benign Het
Tas1r3 G A 4: 155,860,869 R632W probably benign Het
Tlr4 T A 4: 66,833,880 probably null Het
Tmf1 A C 6: 97,158,050 L1001* probably null Het
Tnnt2 A G 1: 135,843,796 probably benign Het
Trank1 G A 9: 111,349,417 probably benign Het
Trdn A T 10: 33,399,158 probably benign Het
Trmt6 A T 2: 132,815,834 V34E probably damaging Het
Trrap T C 5: 144,814,830 F1699L probably benign Het
Ttk A G 9: 83,843,915 R250G probably benign Het
Ttn T A 2: 76,809,904 I13787F probably damaging Het
Uggt1 T A 1: 36,156,313 probably null Het
Ugt2b35 T A 5: 87,008,130 probably benign Het
Ugt2b36 C A 5: 87,066,375 R470L possibly damaging Het
Unk A G 11: 116,053,109 D352G possibly damaging Het
Vmn2r77 G T 7: 86,802,016 C370F probably damaging Het
Vmn2r85 A G 10: 130,429,518 I32T possibly damaging Het
Zfp637 A G 6: 117,845,444 I178V possibly damaging Het
Zfp943 A G 17: 21,992,090 probably null Het
Zyg11a A G 4: 108,210,042 probably benign Het
Other mutations in Dennd5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Dennd5a APN 7 109908372 missense probably benign
IGL01338:Dennd5a APN 7 109919404 missense possibly damaging 0.92
IGL01618:Dennd5a APN 7 109934095 missense probably damaging 1.00
IGL02047:Dennd5a APN 7 109934784 missense possibly damaging 0.92
IGL02277:Dennd5a APN 7 109897969 missense possibly damaging 0.61
IGL02492:Dennd5a APN 7 109933637 missense probably benign
IGL02697:Dennd5a APN 7 109894781 missense probably damaging 1.00
IGL02935:Dennd5a APN 7 109921307 missense possibly damaging 0.80
IGL02986:Dennd5a APN 7 109935524 missense probably benign
IGL03088:Dennd5a APN 7 109908381 missense probably damaging 1.00
IGL03156:Dennd5a APN 7 109919255 splice site probably benign
IGL03181:Dennd5a APN 7 109933658 missense probably damaging 1.00
big_pal UTSW 7 109919423 nonsense probably null
Celestial UTSW 7 109901089 missense probably damaging 1.00
PIT4434001:Dennd5a UTSW 7 109933624 missense probably damaging 1.00
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0092:Dennd5a UTSW 7 109899806 missense possibly damaging 0.95
R0111:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R0517:Dennd5a UTSW 7 109934761 missense probably damaging 1.00
R0546:Dennd5a UTSW 7 109921426 missense probably benign 0.01
R0811:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0812:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0831:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R1075:Dennd5a UTSW 7 109918601 missense probably benign
R1115:Dennd5a UTSW 7 109918761 missense probably damaging 1.00
R1128:Dennd5a UTSW 7 109921334 nonsense probably null
R1300:Dennd5a UTSW 7 109919407 missense probably benign
R1698:Dennd5a UTSW 7 109917380 splice site probably null
R1711:Dennd5a UTSW 7 109918712 missense probably benign 0.00
R1771:Dennd5a UTSW 7 109918686 missense probably damaging 0.98
R1803:Dennd5a UTSW 7 109898613 missense probably benign 0.00
R2064:Dennd5a UTSW 7 109898693 splice site probably benign
R2176:Dennd5a UTSW 7 109905120 intron probably null
R2182:Dennd5a UTSW 7 109933994 missense probably benign 0.03
R2852:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R2853:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R3035:Dennd5a UTSW 7 109921352 missense probably benign 0.00
R3835:Dennd5a UTSW 7 109934242 missense probably benign 0.00
R3953:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3954:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3955:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3957:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R4014:Dennd5a UTSW 7 109935481 critical splice donor site probably null
R4166:Dennd5a UTSW 7 109926825 critical splice donor site probably null
R4362:Dennd5a UTSW 7 109896343 missense probably damaging 1.00
R4567:Dennd5a UTSW 7 109899735 missense probably benign 0.06
R4700:Dennd5a UTSW 7 109921198 missense probably benign 0.01
R4734:Dennd5a UTSW 7 109896336 missense probably damaging 0.96
R4914:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4915:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4918:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4992:Dennd5a UTSW 7 109894712 missense probably damaging 0.98
R5011:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5013:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5034:Dennd5a UTSW 7 109899797 missense probably damaging 0.98
R5194:Dennd5a UTSW 7 109933729 missense probably damaging 1.00
R5359:Dennd5a UTSW 7 109897962 missense probably damaging 1.00
R5430:Dennd5a UTSW 7 109934240 missense probably damaging 1.00
R5586:Dennd5a UTSW 7 109905721 missense possibly damaging 0.72
R5607:Dennd5a UTSW 7 109919423 nonsense probably null
R5608:Dennd5a UTSW 7 109919423 nonsense probably null
R5783:Dennd5a UTSW 7 109894636 missense probably damaging 0.97
R5866:Dennd5a UTSW 7 109919360 missense probably benign 0.00
R5890:Dennd5a UTSW 7 109934221 missense probably benign 0.00
R6053:Dennd5a UTSW 7 109933745 missense probably damaging 1.00
R6247:Dennd5a UTSW 7 109898682 missense probably damaging 1.00
R6362:Dennd5a UTSW 7 109934265 nonsense probably null
R6446:Dennd5a UTSW 7 109894666 missense probably damaging 1.00
R6894:Dennd5a UTSW 7 109901118 missense probably damaging 1.00
R7061:Dennd5a UTSW 7 109905179 missense probably benign 0.19
R7115:Dennd5a UTSW 7 109894754 missense probably damaging 1.00
R7133:Dennd5a UTSW 7 109896242 critical splice donor site probably null
R7302:Dennd5a UTSW 7 109905699 missense probably damaging 0.98
R7339:Dennd5a UTSW 7 109901159 missense probably damaging 1.00
R7704:Dennd5a UTSW 7 109896967 missense possibly damaging 0.85
R7756:Dennd5a UTSW 7 109921507 missense possibly damaging 0.95
R7838:Dennd5a UTSW 7 109933989 missense probably benign
R7873:Dennd5a UTSW 7 109926934 missense probably damaging 1.00
R8124:Dennd5a UTSW 7 109897935 missense probably damaging 1.00
R8309:Dennd5a UTSW 7 109901125 missense probably damaging 1.00
R8345:Dennd5a UTSW 7 109905270 missense possibly damaging 0.55
Z1088:Dennd5a UTSW 7 109894747 missense possibly damaging 0.73
Z1088:Dennd5a UTSW 7 109905273 missense probably damaging 1.00
Z1177:Dennd5a UTSW 7 109934024 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAACTCCTTCCAGCAAGTGACTACG -3'
(R):5'- TGTGAGAGATTCCCAATCCCCACC -3'

Sequencing Primer
(F):5'- CTACGTACAAGGTGCAGGTTC -3'
(R):5'- CTTAACCTCTGTGGCTTCTCTAAAC -3'
Posted On2013-10-16