Incidental Mutation 'R0827:Pnpla6'
ID78318
Institutional Source Beutler Lab
Gene Symbol Pnpla6
Ensembl Gene ENSMUSG00000004565
Gene Namepatatin-like phospholipase domain containing 6
SynonymsNte, Swiss-cheese, MSws
MMRRC Submission 039007-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0827 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3515384-3544267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3517618 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 109 (M109L)
Ref Sequence ENSEMBL: ENSMUSP00000146441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004681] [ENSMUST00000004683] [ENSMUST00000111070] [ENSMUST00000207146] [ENSMUST00000207424] [ENSMUST00000207941] [ENSMUST00000208002] [ENSMUST00000208306] [ENSMUST00000208310] [ENSMUST00000208359] [ENSMUST00000208762]
Predicted Effect probably benign
Transcript: ENSMUST00000004681
AA Change: M87L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004681
Gene: ENSMUSG00000004565
AA Change: M87L

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000004683
SMART Domains Protein: ENSMUSP00000004683
Gene: ENSMUSG00000004567

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:PKD_channel 378 524 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111070
AA Change: M87L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106699
Gene: ENSMUSG00000004565
AA Change: M87L

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 1.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161705
Predicted Effect probably benign
Transcript: ENSMUST00000161842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162797
Predicted Effect possibly damaging
Transcript: ENSMUST00000207146
AA Change: M109L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000207424
AA Change: M87L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000207941
AA Change: M119L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208002
AA Change: M109L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208006
Predicted Effect probably benign
Transcript: ENSMUST00000208306
Predicted Effect probably benign
Transcript: ENSMUST00000208310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208315
Predicted Effect probably benign
Transcript: ENSMUST00000208359
Predicted Effect probably benign
Transcript: ENSMUST00000208762
AA Change: M109L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208851
Predicted Effect probably benign
Transcript: ENSMUST00000208943
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase that deacetylates intracellular phosphatidylcholine to produce glycerophosphocholine. It is thought to function in neurite outgrowth and process elongation during neuronal differentiation. The protein is anchored to the cytoplasmic face of the endoplasmic reticulum in both neurons and non-neuronal cells. Mutations in this gene result in autosomal recessive spastic paraplegia, and the protein is the target for neurodegeneration induced by organophosphorus compounds and chemical warfare agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during early gestation. Conditional inactivation in the central nervous system leads to neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,671 S1397P probably benign Het
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ankk1 A G 9: 49,421,737 I149T possibly damaging Het
Ankrd63 A G 2: 118,702,553 S296P possibly damaging Het
Arpc1b T G 5: 145,125,756 C227G probably benign Het
B4gat1 A G 19: 5,039,697 R241G possibly damaging Het
Ccar2 T C 14: 70,139,838 N751D probably benign Het
Cd55b T C 1: 130,414,236 I221M probably damaging Het
Cntn5 A G 9: 9,666,938 V1032A possibly damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Colec10 G A 15: 54,462,584 C270Y probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cyp2j12 T G 4: 96,112,862 probably benign Het
Dennd5a G A 7: 109,899,731 T999M probably damaging Het
Dusp13 C A 14: 21,742,771 V29L probably benign Het
Efr3a A C 15: 65,853,551 D83A possibly damaging Het
Elmod2 A G 8: 83,316,795 probably null Het
Eml3 C A 19: 8,938,466 T640K probably damaging Het
Eps8l1 T C 7: 4,477,389 V543A possibly damaging Het
Ermn T C 2: 58,048,251 K117E probably damaging Het
F830045P16Rik A G 2: 129,472,776 S194P probably benign Het
Faim2 A G 15: 99,524,736 V60A probably benign Het
Fancd2 G A 6: 113,586,249 probably null Het
Fbxo43 A T 15: 36,162,969 S31T possibly damaging Het
Gab2 G A 7: 97,300,332 R411Q probably damaging Het
Gm17727 A T 9: 35,777,851 L12Q probably damaging Het
Gpm6a A T 8: 55,058,883 D264V probably damaging Het
Hist1h1t A G 13: 23,696,221 D119G probably benign Het
Hsp90aa1 T C 12: 110,692,695 E556G probably benign Het
Ifi203 A T 1: 173,928,463 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnc3 A G 7: 44,595,206 T307A probably damaging Het
Kin C A 2: 10,090,376 probably benign Het
Knl1 T C 2: 119,088,901 probably benign Het
Lrp4 G A 2: 91,495,041 V1404M probably damaging Het
Lrrc71 T A 3: 87,742,645 probably null Het
Med13l T C 5: 118,726,247 probably benign Het
Mfap5 A G 6: 122,520,920 D39G probably damaging Het
Mlxipl T C 5: 135,132,738 S504P probably benign Het
Myo3a T G 2: 22,558,215 Y1D probably damaging Het
Nek1 A G 8: 61,105,648 probably benign Het
Nfkbiz T C 16: 55,816,367 R524G probably damaging Het
Npbwr1 T C 1: 5,916,789 T169A possibly damaging Het
Nuggc T C 14: 65,608,891 Y84H probably damaging Het
Nxph3 G A 11: 95,511,426 S54L probably benign Het
Olfr311 T C 11: 58,841,771 I219T probably damaging Het
Olfr532 A G 7: 140,419,467 F102S probably damaging Het
Ostn A G 16: 27,324,631 N70D probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Ppil6 T A 10: 41,494,504 probably benign Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Ptprd A T 4: 76,128,915 D371E probably damaging Het
Ripor2 T A 13: 24,694,186 F315I probably damaging Het
Rmi2 G A 16: 10,835,240 G51S probably damaging Het
Scg3 A G 9: 75,683,697 I10T possibly damaging Het
Scn9a T A 2: 66,536,124 K761* probably null Het
Scyl2 A G 10: 89,657,865 L347P possibly damaging Het
Sh3d21 A G 4: 126,152,271 probably benign Het
Shc1 T A 3: 89,426,783 probably null Het
Slbp A G 5: 33,643,822 S182P probably damaging Het
Slc24a1 C T 9: 64,928,190 G885D probably benign Het
Slc24a3 T C 2: 145,518,492 probably benign Het
Sowahb T G 5: 93,043,286 N525H probably damaging Het
Sppl3 T A 5: 115,082,333 C101* probably null Het
Srsf5 A G 12: 80,949,540 K163E probably damaging Het
Sult2a4 A G 7: 13,984,961 I119T probably benign Het
Svep1 A G 4: 58,053,113 probably benign Het
Tas1r3 G A 4: 155,860,869 R632W probably benign Het
Tlr4 T A 4: 66,833,880 probably null Het
Tmf1 A C 6: 97,158,050 L1001* probably null Het
Tnnt2 A G 1: 135,843,796 probably benign Het
Trank1 G A 9: 111,349,417 probably benign Het
Trdn A T 10: 33,399,158 probably benign Het
Trmt6 A T 2: 132,815,834 V34E probably damaging Het
Trrap T C 5: 144,814,830 F1699L probably benign Het
Ttk A G 9: 83,843,915 R250G probably benign Het
Ttn T A 2: 76,809,904 I13787F probably damaging Het
Uggt1 T A 1: 36,156,313 probably null Het
Ugt2b35 T A 5: 87,008,130 probably benign Het
Ugt2b36 C A 5: 87,066,375 R470L possibly damaging Het
Unk A G 11: 116,053,109 D352G possibly damaging Het
Vmn2r77 G T 7: 86,802,016 C370F probably damaging Het
Vmn2r85 A G 10: 130,429,518 I32T possibly damaging Het
Zfp637 A G 6: 117,845,444 I178V possibly damaging Het
Zfp943 A G 17: 21,992,090 probably null Het
Zyg11a A G 4: 108,210,042 probably benign Het
Other mutations in Pnpla6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pnpla6 APN 8 3523808 missense probably damaging 1.00
IGL00820:Pnpla6 APN 8 3532358 missense possibly damaging 0.95
IGL00839:Pnpla6 APN 8 3542299 missense probably benign 0.05
IGL01732:Pnpla6 APN 8 3522616 missense probably damaging 0.99
IGL01973:Pnpla6 APN 8 3517619 missense probably damaging 1.00
IGL02267:Pnpla6 APN 8 3517327 missense probably benign 0.00
IGL03246:Pnpla6 APN 8 3531530 missense probably benign 0.01
IGL03286:Pnpla6 APN 8 3531473 missense probably damaging 0.99
I0000:Pnpla6 UTSW 8 3542322 missense probably benign
R0141:Pnpla6 UTSW 8 3532117 critical splice donor site probably null
R0180:Pnpla6 UTSW 8 3524250 critical splice acceptor site probably null
R0377:Pnpla6 UTSW 8 3541501 missense probably damaging 1.00
R0563:Pnpla6 UTSW 8 3523333 missense possibly damaging 0.51
R0660:Pnpla6 UTSW 8 3522269 unclassified probably benign
R0786:Pnpla6 UTSW 8 3523317 missense probably benign
R0882:Pnpla6 UTSW 8 3517081 missense probably damaging 1.00
R1512:Pnpla6 UTSW 8 3535459 splice site probably benign
R1552:Pnpla6 UTSW 8 3522403 missense probably damaging 1.00
R1609:Pnpla6 UTSW 8 3517135 missense probably damaging 1.00
R1770:Pnpla6 UTSW 8 3534634 missense possibly damaging 0.94
R1779:Pnpla6 UTSW 8 3541404 missense probably damaging 1.00
R1987:Pnpla6 UTSW 8 3542370 missense probably benign 0.00
R3079:Pnpla6 UTSW 8 3541512 missense probably benign 0.25
R3125:Pnpla6 UTSW 8 3534670 missense probably null 1.00
R4171:Pnpla6 UTSW 8 3543997 missense probably benign 0.09
R4281:Pnpla6 UTSW 8 3521513 missense probably damaging 1.00
R4674:Pnpla6 UTSW 8 3521412 missense probably damaging 1.00
R4776:Pnpla6 UTSW 8 3523818 missense probably benign 0.01
R4779:Pnpla6 UTSW 8 3522838 missense probably benign 0.00
R5114:Pnpla6 UTSW 8 3522613 missense probably damaging 0.98
R5459:Pnpla6 UTSW 8 3535829 missense probably benign 0.01
R5510:Pnpla6 UTSW 8 3521397 missense probably damaging 0.99
R5538:Pnpla6 UTSW 8 3531508 missense probably benign 0.01
R5664:Pnpla6 UTSW 8 3537478 missense probably damaging 0.98
R6063:Pnpla6 UTSW 8 3524156 missense probably benign 0.21
R6314:Pnpla6 UTSW 8 3521572 missense probably benign 0.39
R6321:Pnpla6 UTSW 8 3544015 missense probably benign
R6454:Pnpla6 UTSW 8 3537986 missense probably damaging 0.99
R6477:Pnpla6 UTSW 8 3536627 missense probably benign 0.00
R6524:Pnpla6 UTSW 8 3534519 splice site probably null
R6809:Pnpla6 UTSW 8 3534611 missense possibly damaging 0.72
R6975:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7293:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7389:Pnpla6 UTSW 8 3543981 nonsense probably null
R7520:Pnpla6 UTSW 8 3537508 missense probably damaging 1.00
R7666:Pnpla6 UTSW 8 3541591 missense probably benign 0.01
R7733:Pnpla6 UTSW 8 3522660 missense probably benign 0.01
X0018:Pnpla6 UTSW 8 3517337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCGGAAGGTGAGTTCCAAGACC -3'
(R):5'- TGAGATGGCAGAACCCTGAGATAGC -3'

Sequencing Primer
(F):5'- GGTGAGTTCCAAGACCTACTG -3'
(R):5'- GATAGCCCCTGCCAACTGAG -3'
Posted On2013-10-16