Incidental Mutation 'R0827:Nek1'
Institutional Source Beutler Lab
Gene Symbol Nek1
Ensembl Gene ENSMUSG00000031644
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 1
Synonymskidney, anemia and testis, kat, D8Ertd790e
MMRRC Submission 039007-MU
Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0827 (G1)
Quality Score225
Status Validated
Chromosomal Location60993195-61131346 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 61105648 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]
Predicted Effect probably benign
Transcript: ENSMUST00000034065
SMART Domains Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644

S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 556 592 N/A INTRINSIC
coiled coil region 647 685 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120689
SMART Domains Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644

S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 487 510 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
coiled coil region 584 620 N/A INTRINSIC
coiled coil region 675 713 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
low complexity region 1158 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155664
Predicted Effect probably benign
Transcript: ENSMUST00000211256
Predicted Effect probably benign
Transcript: ENSMUST00000211672
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,671 S1397P probably benign Het
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ankk1 A G 9: 49,421,737 I149T possibly damaging Het
Ankrd63 A G 2: 118,702,553 S296P possibly damaging Het
Arpc1b T G 5: 145,125,756 C227G probably benign Het
B4gat1 A G 19: 5,039,697 R241G possibly damaging Het
Ccar2 T C 14: 70,139,838 N751D probably benign Het
Cd55b T C 1: 130,414,236 I221M probably damaging Het
Cntn5 A G 9: 9,666,938 V1032A possibly damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Colec10 G A 15: 54,462,584 C270Y probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cyp2j12 T G 4: 96,112,862 probably benign Het
Dennd5a G A 7: 109,899,731 T999M probably damaging Het
Dusp13 C A 14: 21,742,771 V29L probably benign Het
Efr3a A C 15: 65,853,551 D83A possibly damaging Het
Elmod2 A G 8: 83,316,795 probably null Het
Eml3 C A 19: 8,938,466 T640K probably damaging Het
Eps8l1 T C 7: 4,477,389 V543A possibly damaging Het
Ermn T C 2: 58,048,251 K117E probably damaging Het
F830045P16Rik A G 2: 129,472,776 S194P probably benign Het
Faim2 A G 15: 99,524,736 V60A probably benign Het
Fancd2 G A 6: 113,586,249 probably null Het
Fbxo43 A T 15: 36,162,969 S31T possibly damaging Het
Gab2 G A 7: 97,300,332 R411Q probably damaging Het
Gm17727 A T 9: 35,777,851 L12Q probably damaging Het
Gpm6a A T 8: 55,058,883 D264V probably damaging Het
Hist1h1t A G 13: 23,696,221 D119G probably benign Het
Hsp90aa1 T C 12: 110,692,695 E556G probably benign Het
Ifi203 A T 1: 173,928,463 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnc3 A G 7: 44,595,206 T307A probably damaging Het
Kin C A 2: 10,090,376 probably benign Het
Knl1 T C 2: 119,088,901 probably benign Het
Lrp4 G A 2: 91,495,041 V1404M probably damaging Het
Lrrc71 T A 3: 87,742,645 probably null Het
Med13l T C 5: 118,726,247 probably benign Het
Mfap5 A G 6: 122,520,920 D39G probably damaging Het
Mlxipl T C 5: 135,132,738 S504P probably benign Het
Myo3a T G 2: 22,558,215 Y1D probably damaging Het
Nfkbiz T C 16: 55,816,367 R524G probably damaging Het
Npbwr1 T C 1: 5,916,789 T169A possibly damaging Het
Nuggc T C 14: 65,608,891 Y84H probably damaging Het
Nxph3 G A 11: 95,511,426 S54L probably benign Het
Olfr311 T C 11: 58,841,771 I219T probably damaging Het
Olfr532 A G 7: 140,419,467 F102S probably damaging Het
Ostn A G 16: 27,324,631 N70D probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pnpla6 A T 8: 3,517,618 M109L possibly damaging Het
Ppil6 T A 10: 41,494,504 probably benign Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Ptprd A T 4: 76,128,915 D371E probably damaging Het
Ripor2 T A 13: 24,694,186 F315I probably damaging Het
Rmi2 G A 16: 10,835,240 G51S probably damaging Het
Scg3 A G 9: 75,683,697 I10T possibly damaging Het
Scn9a T A 2: 66,536,124 K761* probably null Het
Scyl2 A G 10: 89,657,865 L347P possibly damaging Het
Sh3d21 A G 4: 126,152,271 probably benign Het
Shc1 T A 3: 89,426,783 probably null Het
Slbp A G 5: 33,643,822 S182P probably damaging Het
Slc24a1 C T 9: 64,928,190 G885D probably benign Het
Slc24a3 T C 2: 145,518,492 probably benign Het
Sowahb T G 5: 93,043,286 N525H probably damaging Het
Sppl3 T A 5: 115,082,333 C101* probably null Het
Srsf5 A G 12: 80,949,540 K163E probably damaging Het
Sult2a4 A G 7: 13,984,961 I119T probably benign Het
Svep1 A G 4: 58,053,113 probably benign Het
Tas1r3 G A 4: 155,860,869 R632W probably benign Het
Tlr4 T A 4: 66,833,880 probably null Het
Tmf1 A C 6: 97,158,050 L1001* probably null Het
Tnnt2 A G 1: 135,843,796 probably benign Het
Trank1 G A 9: 111,349,417 probably benign Het
Trdn A T 10: 33,399,158 probably benign Het
Trmt6 A T 2: 132,815,834 V34E probably damaging Het
Trrap T C 5: 144,814,830 F1699L probably benign Het
Ttk A G 9: 83,843,915 R250G probably benign Het
Ttn T A 2: 76,809,904 I13787F probably damaging Het
Uggt1 T A 1: 36,156,313 probably null Het
Ugt2b35 T A 5: 87,008,130 probably benign Het
Ugt2b36 C A 5: 87,066,375 R470L possibly damaging Het
Unk A G 11: 116,053,109 D352G possibly damaging Het
Vmn2r77 G T 7: 86,802,016 C370F probably damaging Het
Vmn2r85 A G 10: 130,429,518 I32T possibly damaging Het
Zfp637 A G 6: 117,845,444 I178V possibly damaging Het
Zfp943 A G 17: 21,992,090 probably null Het
Zyg11a A G 4: 108,210,042 probably benign Het
Other mutations in Nek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Nek1 APN 8 61043284 missense probably benign 0.00
IGL01075:Nek1 APN 8 61124132 missense possibly damaging 0.64
IGL01122:Nek1 APN 8 61120966 missense possibly damaging 0.80
IGL01151:Nek1 APN 8 61020077 missense probably damaging 1.00
IGL01286:Nek1 APN 8 61124216 missense possibly damaging 0.64
IGL01377:Nek1 APN 8 61089456 missense probably benign
IGL01485:Nek1 APN 8 61049826 missense probably benign 0.02
IGL01688:Nek1 APN 8 61105597 nonsense probably null
IGL01806:Nek1 APN 8 61124212 missense possibly damaging 0.82
IGL02006:Nek1 APN 8 61104192 missense probably benign 0.20
IGL02304:Nek1 APN 8 61012167 missense probably damaging 1.00
IGL02659:Nek1 APN 8 61089480 missense probably benign 0.16
IGL02662:Nek1 APN 8 61104184 missense probably benign 0.00
IGL02801:Nek1 APN 8 61121061 critical splice donor site probably null
IGL02806:Nek1 APN 8 61044086 missense probably benign 0.15
IGL03037:Nek1 APN 8 61034052 missense probably benign 0.16
IGL03252:Nek1 APN 8 61072330 nonsense probably null
P0014:Nek1 UTSW 8 61071747 splice site probably benign
R0019:Nek1 UTSW 8 61089734 missense probably benign 0.01
R0403:Nek1 UTSW 8 61106855 missense probably damaging 0.99
R0464:Nek1 UTSW 8 61072273 splice site probably benign
R0726:Nek1 UTSW 8 61089592 missense probably damaging 1.00
R0761:Nek1 UTSW 8 61089455 missense probably benign
R0972:Nek1 UTSW 8 61089431 splice site probably null
R1268:Nek1 UTSW 8 61022264 missense probably damaging 1.00
R1343:Nek1 UTSW 8 61028675 missense probably damaging 1.00
R1415:Nek1 UTSW 8 61089686 missense probably benign 0.00
R1466:Nek1 UTSW 8 61125136 splice site probably benign
R1480:Nek1 UTSW 8 61124326 splice site probably null
R1526:Nek1 UTSW 8 61049941 missense probably benign 0.26
R1552:Nek1 UTSW 8 61006737 missense probably damaging 0.99
R1606:Nek1 UTSW 8 61124276 missense possibly damaging 0.82
R1650:Nek1 UTSW 8 61036076 missense probably benign 0.00
R1757:Nek1 UTSW 8 61089813 splice site probably null
R1808:Nek1 UTSW 8 61016230 missense probably damaging 1.00
R1966:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R2067:Nek1 UTSW 8 61007162 missense probably damaging 1.00
R2111:Nek1 UTSW 8 61124326 splice site probably null
R2113:Nek1 UTSW 8 61016293 missense probably damaging 1.00
R2143:Nek1 UTSW 8 61028696 missense probably damaging 1.00
R2255:Nek1 UTSW 8 61089773 missense probably damaging 1.00
R2422:Nek1 UTSW 8 61019901 missense probably damaging 1.00
R3848:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3849:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3850:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R4418:Nek1 UTSW 8 61106864 missense probably damaging 1.00
R4526:Nek1 UTSW 8 61106944 missense probably damaging 0.99
R4533:Nek1 UTSW 8 61007213 missense possibly damaging 0.95
R4544:Nek1 UTSW 8 61016304 nonsense probably null
R4677:Nek1 UTSW 8 61028806 missense probably damaging 0.99
R4739:Nek1 UTSW 8 61098511 missense probably benign 0.32
R5068:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R5421:Nek1 UTSW 8 61006677 missense possibly damaging 0.81
R5516:Nek1 UTSW 8 61089489 missense probably benign 0.03
R5855:Nek1 UTSW 8 61016272 missense probably damaging 1.00
R6125:Nek1 UTSW 8 61028701 missense probably damaging 1.00
R6267:Nek1 UTSW 8 61072309 nonsense probably null
R6292:Nek1 UTSW 8 61054736 splice site probably null
R6296:Nek1 UTSW 8 61072309 nonsense probably null
R6458:Nek1 UTSW 8 61100012 missense probably benign 0.00
R6568:Nek1 UTSW 8 61106821 missense probably benign 0.00
R6629:Nek1 UTSW 8 61054333 splice site probably null
R6867:Nek1 UTSW 8 61072330 missense possibly damaging 0.81
R7122:Nek1 UTSW 8 61106795 missense probably benign 0.00
R7193:Nek1 UTSW 8 61073578 missense probably damaging 0.99
R7272:Nek1 UTSW 8 61125086 missense probably benign 0.34
R7356:Nek1 UTSW 8 61120960 missense probably benign 0.02
R7368:Nek1 UTSW 8 61089707 missense probably benign 0.24
R7478:Nek1 UTSW 8 61130145 missense probably benign 0.03
R7479:Nek1 UTSW 8 61130145 missense probably benign 0.03
R7512:Nek1 UTSW 8 61130145 missense probably benign 0.03
R7715:Nek1 UTSW 8 61006760 missense probably damaging 0.98
R7984:Nek1 UTSW 8 61121053 nonsense probably null
R8271:Nek1 UTSW 8 61105612 missense probably benign 0.04
R8431:Nek1 UTSW 8 61034032 missense possibly damaging 0.95
RF023:Nek1 UTSW 8 61072745 splice site probably null
X0028:Nek1 UTSW 8 61043258 missense probably benign 0.19
X0066:Nek1 UTSW 8 61125128 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ccgactaggccatcttttgatac -3'
Posted On2013-10-16