Incidental Mutation 'R0827:Slc24a1'
ID78326
Institutional Source Beutler Lab
Gene Symbol Slc24a1
Ensembl Gene ENSMUSG00000034452
Gene Namesolute carrier family 24 (sodium/potassium/calcium exchanger), member 1
Synonyms
MMRRC Submission 039007-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R0827 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location64922861-64951607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64928190 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 885 (G885D)
Ref Sequence ENSEMBL: ENSMUSP00000035616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037798]
Predicted Effect probably benign
Transcript: ENSMUST00000037798
AA Change: G885D

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000035616
Gene: ENSMUSG00000034452
AA Change: G885D

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Na_Ca_ex 425 569 1.7e-28 PFAM
low complexity region 683 699 N/A INTRINSIC
coiled coil region 747 776 N/A INTRINSIC
coiled coil region 818 847 N/A INTRINSIC
coiled coil region 898 928 N/A INTRINSIC
transmembrane domain 939 956 N/A INTRINSIC
Pfam:Na_Ca_ex 967 1118 1.7e-33 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium-dependent sodium/calcium exchanger protein family. The encoded protein plays an important role in sodium/calcium exchange in retinal rod and cone photoreceptors by mediating the extrusion of one calcium ion and one potassium ion in exchange for four sodium ions. Mutations in this gene may play a role in congenital stationary night blindness. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele display slow progressive retinal degeneration and develop stationary night blindness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,671 S1397P probably benign Het
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ankk1 A G 9: 49,421,737 I149T possibly damaging Het
Ankrd63 A G 2: 118,702,553 S296P possibly damaging Het
Arpc1b T G 5: 145,125,756 C227G probably benign Het
B4gat1 A G 19: 5,039,697 R241G possibly damaging Het
Ccar2 T C 14: 70,139,838 N751D probably benign Het
Cd55b T C 1: 130,414,236 I221M probably damaging Het
Cntn5 A G 9: 9,666,938 V1032A possibly damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Colec10 G A 15: 54,462,584 C270Y probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cyp2j12 T G 4: 96,112,862 probably benign Het
Dennd5a G A 7: 109,899,731 T999M probably damaging Het
Dusp13 C A 14: 21,742,771 V29L probably benign Het
Efr3a A C 15: 65,853,551 D83A possibly damaging Het
Elmod2 A G 8: 83,316,795 probably null Het
Eml3 C A 19: 8,938,466 T640K probably damaging Het
Eps8l1 T C 7: 4,477,389 V543A possibly damaging Het
Ermn T C 2: 58,048,251 K117E probably damaging Het
F830045P16Rik A G 2: 129,472,776 S194P probably benign Het
Faim2 A G 15: 99,524,736 V60A probably benign Het
Fancd2 G A 6: 113,586,249 probably null Het
Fbxo43 A T 15: 36,162,969 S31T possibly damaging Het
Gab2 G A 7: 97,300,332 R411Q probably damaging Het
Gm17727 A T 9: 35,777,851 L12Q probably damaging Het
Gpm6a A T 8: 55,058,883 D264V probably damaging Het
Hist1h1t A G 13: 23,696,221 D119G probably benign Het
Hsp90aa1 T C 12: 110,692,695 E556G probably benign Het
Ifi203 A T 1: 173,928,463 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnc3 A G 7: 44,595,206 T307A probably damaging Het
Kin C A 2: 10,090,376 probably benign Het
Knl1 T C 2: 119,088,901 probably benign Het
Lrp4 G A 2: 91,495,041 V1404M probably damaging Het
Lrrc71 T A 3: 87,742,645 probably null Het
Med13l T C 5: 118,726,247 probably benign Het
Mfap5 A G 6: 122,520,920 D39G probably damaging Het
Mlxipl T C 5: 135,132,738 S504P probably benign Het
Myo3a T G 2: 22,558,215 Y1D probably damaging Het
Nek1 A G 8: 61,105,648 probably benign Het
Nfkbiz T C 16: 55,816,367 R524G probably damaging Het
Npbwr1 T C 1: 5,916,789 T169A possibly damaging Het
Nuggc T C 14: 65,608,891 Y84H probably damaging Het
Nxph3 G A 11: 95,511,426 S54L probably benign Het
Olfr311 T C 11: 58,841,771 I219T probably damaging Het
Olfr532 A G 7: 140,419,467 F102S probably damaging Het
Ostn A G 16: 27,324,631 N70D probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pnpla6 A T 8: 3,517,618 M109L possibly damaging Het
Ppil6 T A 10: 41,494,504 probably benign Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Ptprd A T 4: 76,128,915 D371E probably damaging Het
Ripor2 T A 13: 24,694,186 F315I probably damaging Het
Rmi2 G A 16: 10,835,240 G51S probably damaging Het
Scg3 A G 9: 75,683,697 I10T possibly damaging Het
Scn9a T A 2: 66,536,124 K761* probably null Het
Scyl2 A G 10: 89,657,865 L347P possibly damaging Het
Sh3d21 A G 4: 126,152,271 probably benign Het
Shc1 T A 3: 89,426,783 probably null Het
Slbp A G 5: 33,643,822 S182P probably damaging Het
Slc24a3 T C 2: 145,518,492 probably benign Het
Sowahb T G 5: 93,043,286 N525H probably damaging Het
Sppl3 T A 5: 115,082,333 C101* probably null Het
Srsf5 A G 12: 80,949,540 K163E probably damaging Het
Sult2a4 A G 7: 13,984,961 I119T probably benign Het
Svep1 A G 4: 58,053,113 probably benign Het
Tas1r3 G A 4: 155,860,869 R632W probably benign Het
Tlr4 T A 4: 66,833,880 probably null Het
Tmf1 A C 6: 97,158,050 L1001* probably null Het
Tnnt2 A G 1: 135,843,796 probably benign Het
Trank1 G A 9: 111,349,417 probably benign Het
Trdn A T 10: 33,399,158 probably benign Het
Trmt6 A T 2: 132,815,834 V34E probably damaging Het
Trrap T C 5: 144,814,830 F1699L probably benign Het
Ttk A G 9: 83,843,915 R250G probably benign Het
Ttn T A 2: 76,809,904 I13787F probably damaging Het
Uggt1 T A 1: 36,156,313 probably null Het
Ugt2b35 T A 5: 87,008,130 probably benign Het
Ugt2b36 C A 5: 87,066,375 R470L possibly damaging Het
Unk A G 11: 116,053,109 D352G possibly damaging Het
Vmn2r77 G T 7: 86,802,016 C370F probably damaging Het
Vmn2r85 A G 10: 130,429,518 I32T possibly damaging Het
Zfp637 A G 6: 117,845,444 I178V possibly damaging Het
Zfp943 A G 17: 21,992,090 probably null Het
Zyg11a A G 4: 108,210,042 probably benign Het
Other mutations in Slc24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Slc24a1 APN 9 64928019 missense probably damaging 0.99
IGL01602:Slc24a1 APN 9 64926181 missense probably damaging 1.00
IGL03111:Slc24a1 APN 9 64926326 missense probably damaging 0.98
R0092:Slc24a1 UTSW 9 64948752 missense unknown
R0708:Slc24a1 UTSW 9 64947890 missense unknown
R1294:Slc24a1 UTSW 9 64936013 missense unknown
R1613:Slc24a1 UTSW 9 64948696 missense unknown
R2858:Slc24a1 UTSW 9 64949332 missense unknown
R3779:Slc24a1 UTSW 9 64948297 missense unknown
R3899:Slc24a1 UTSW 9 64928144 missense probably damaging 0.99
R3900:Slc24a1 UTSW 9 64928144 missense probably damaging 0.99
R4409:Slc24a1 UTSW 9 64948224 missense probably benign 0.39
R4732:Slc24a1 UTSW 9 64949554 missense probably benign 0.23
R4733:Slc24a1 UTSW 9 64949554 missense probably benign 0.23
R4745:Slc24a1 UTSW 9 64949476 missense unknown
R4915:Slc24a1 UTSW 9 64947931 missense unknown
R5371:Slc24a1 UTSW 9 64949268 missense unknown
R5448:Slc24a1 UTSW 9 64948327 missense probably benign 0.39
R5540:Slc24a1 UTSW 9 64948581 missense unknown
R5863:Slc24a1 UTSW 9 64928542 missense unknown
R6161:Slc24a1 UTSW 9 64937263 missense unknown
R6810:Slc24a1 UTSW 9 64948323 missense probably benign 0.39
R7215:Slc24a1 UTSW 9 64928503 missense unknown
R7380:Slc24a1 UTSW 9 64948533 missense unknown
R7453:Slc24a1 UTSW 9 64949301 missense unknown
R7466:Slc24a1 UTSW 9 64928404 missense unknown
R7488:Slc24a1 UTSW 9 64924482 missense probably benign 0.41
R7672:Slc24a1 UTSW 9 64947927 missense unknown
R7939:Slc24a1 UTSW 9 64928366 missense probably benign 0.33
R7984:Slc24a1 UTSW 9 64949529 nonsense probably null
R8097:Slc24a1 UTSW 9 64924452 missense probably damaging 0.97
X0063:Slc24a1 UTSW 9 64949143 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTCAGGCCATTCCAGAGACAGAG -3'
(R):5'- AAATCAGGCACAGTTGCTGCCG -3'

Sequencing Primer
(F):5'- GGctcctcattttcctcctcc -3'
(R):5'- cagaaggaaaagaacaagaaggg -3'
Posted On2013-10-16