Incidental Mutation 'R0827:Scyl2'
ID78333
Institutional Source Beutler Lab
Gene Symbol Scyl2
Ensembl Gene ENSMUSG00000069539
Gene NameSCY1-like 2 (S. cerevisiae)
SynonymsCVAK104, D10Ertd802e
MMRRC Submission 039007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R0827 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location89638721-89686285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89657865 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 347 (L347P)
Ref Sequence ENSEMBL: ENSMUSP00000133992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092227] [ENSMUST00000174252] [ENSMUST00000174492]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092227
AA Change: L347P

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089874
Gene: ENSMUSG00000069539
AA Change: L347P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 324 9.7e-15 PFAM
Pfam:Pkinase 32 327 4.6e-24 PFAM
low complexity region 356 369 N/A INTRINSIC
low complexity region 679 704 N/A INTRINSIC
low complexity region 896 921 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173526
Predicted Effect possibly damaging
Transcript: ENSMUST00000174252
AA Change: L347P

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133992
Gene: ENSMUSG00000069539
AA Change: L347P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 324 6.4e-15 PFAM
Pfam:Pkinase 32 327 2.9e-26 PFAM
low complexity region 356 369 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 897 922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174492
AA Change: L72P

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134366
Gene: ENSMUSG00000069539
AA Change: L72P

DomainStartEndE-ValueType
SCOP:d1b3ua_ 66 259 1e-7 SMART
Meta Mutation Damage Score 0.4808 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene associates with clathrin-coated complexes at the plasma membrane and with endocytic coated vesicles. The encoded protein phosphorylates the beta2 subunit of the plasma membrane adapter complex AP2 and interacts with clathrin, showing involvement in clathrin-dependent pathways between the trans-Golgi network and the endosomal system. In addition, this protein has a role in the Wnt signaling pathway by targeting frizzled 5 (Fzd5) for lysosomal degradation. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, absent gastric milk in neonates, postnatal growth retardation, sensory-motor deficits and limb grapsing. Mice homozygous for a conditional allele exhibit similar phenotypes with near complete loss of CA3 neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,671 S1397P probably benign Het
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ankk1 A G 9: 49,421,737 I149T possibly damaging Het
Ankrd63 A G 2: 118,702,553 S296P possibly damaging Het
Arpc1b T G 5: 145,125,756 C227G probably benign Het
B4gat1 A G 19: 5,039,697 R241G possibly damaging Het
Ccar2 T C 14: 70,139,838 N751D probably benign Het
Cd55b T C 1: 130,414,236 I221M probably damaging Het
Cntn5 A G 9: 9,666,938 V1032A possibly damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Colec10 G A 15: 54,462,584 C270Y probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cyp2j12 T G 4: 96,112,862 probably benign Het
Dennd5a G A 7: 109,899,731 T999M probably damaging Het
Dusp13 C A 14: 21,742,771 V29L probably benign Het
Efr3a A C 15: 65,853,551 D83A possibly damaging Het
Elmod2 A G 8: 83,316,795 probably null Het
Eml3 C A 19: 8,938,466 T640K probably damaging Het
Eps8l1 T C 7: 4,477,389 V543A possibly damaging Het
Ermn T C 2: 58,048,251 K117E probably damaging Het
F830045P16Rik A G 2: 129,472,776 S194P probably benign Het
Faim2 A G 15: 99,524,736 V60A probably benign Het
Fancd2 G A 6: 113,586,249 probably null Het
Fbxo43 A T 15: 36,162,969 S31T possibly damaging Het
Gab2 G A 7: 97,300,332 R411Q probably damaging Het
Gm17727 A T 9: 35,777,851 L12Q probably damaging Het
Gpm6a A T 8: 55,058,883 D264V probably damaging Het
Hist1h1t A G 13: 23,696,221 D119G probably benign Het
Hsp90aa1 T C 12: 110,692,695 E556G probably benign Het
Ifi203 A T 1: 173,928,463 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnc3 A G 7: 44,595,206 T307A probably damaging Het
Kin C A 2: 10,090,376 probably benign Het
Knl1 T C 2: 119,088,901 probably benign Het
Lrp4 G A 2: 91,495,041 V1404M probably damaging Het
Lrrc71 T A 3: 87,742,645 probably null Het
Med13l T C 5: 118,726,247 probably benign Het
Mfap5 A G 6: 122,520,920 D39G probably damaging Het
Mlxipl T C 5: 135,132,738 S504P probably benign Het
Myo3a T G 2: 22,558,215 Y1D probably damaging Het
Nek1 A G 8: 61,105,648 probably benign Het
Nfkbiz T C 16: 55,816,367 R524G probably damaging Het
Npbwr1 T C 1: 5,916,789 T169A possibly damaging Het
Nuggc T C 14: 65,608,891 Y84H probably damaging Het
Nxph3 G A 11: 95,511,426 S54L probably benign Het
Olfr311 T C 11: 58,841,771 I219T probably damaging Het
Olfr532 A G 7: 140,419,467 F102S probably damaging Het
Ostn A G 16: 27,324,631 N70D probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pnpla6 A T 8: 3,517,618 M109L possibly damaging Het
Ppil6 T A 10: 41,494,504 probably benign Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Ptprd A T 4: 76,128,915 D371E probably damaging Het
Ripor2 T A 13: 24,694,186 F315I probably damaging Het
Rmi2 G A 16: 10,835,240 G51S probably damaging Het
Scg3 A G 9: 75,683,697 I10T possibly damaging Het
Scn9a T A 2: 66,536,124 K761* probably null Het
Sh3d21 A G 4: 126,152,271 probably benign Het
Shc1 T A 3: 89,426,783 probably null Het
Slbp A G 5: 33,643,822 S182P probably damaging Het
Slc24a1 C T 9: 64,928,190 G885D probably benign Het
Slc24a3 T C 2: 145,518,492 probably benign Het
Sowahb T G 5: 93,043,286 N525H probably damaging Het
Sppl3 T A 5: 115,082,333 C101* probably null Het
Srsf5 A G 12: 80,949,540 K163E probably damaging Het
Sult2a4 A G 7: 13,984,961 I119T probably benign Het
Svep1 A G 4: 58,053,113 probably benign Het
Tas1r3 G A 4: 155,860,869 R632W probably benign Het
Tlr4 T A 4: 66,833,880 probably null Het
Tmf1 A C 6: 97,158,050 L1001* probably null Het
Tnnt2 A G 1: 135,843,796 probably benign Het
Trank1 G A 9: 111,349,417 probably benign Het
Trdn A T 10: 33,399,158 probably benign Het
Trmt6 A T 2: 132,815,834 V34E probably damaging Het
Trrap T C 5: 144,814,830 F1699L probably benign Het
Ttk A G 9: 83,843,915 R250G probably benign Het
Ttn T A 2: 76,809,904 I13787F probably damaging Het
Uggt1 T A 1: 36,156,313 probably null Het
Ugt2b35 T A 5: 87,008,130 probably benign Het
Ugt2b36 C A 5: 87,066,375 R470L possibly damaging Het
Unk A G 11: 116,053,109 D352G possibly damaging Het
Vmn2r77 G T 7: 86,802,016 C370F probably damaging Het
Vmn2r85 A G 10: 130,429,518 I32T possibly damaging Het
Zfp637 A G 6: 117,845,444 I178V possibly damaging Het
Zfp943 A G 17: 21,992,090 probably null Het
Zyg11a A G 4: 108,210,042 probably benign Het
Other mutations in Scyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Scyl2 APN 10 89657809 critical splice donor site probably null
IGL01141:Scyl2 APN 10 89640635 missense probably benign
IGL01597:Scyl2 APN 10 89652987 missense probably damaging 0.99
IGL01713:Scyl2 APN 10 89654225 missense probably damaging 1.00
IGL02349:Scyl2 APN 10 89657938 splice site probably benign
IGL02466:Scyl2 APN 10 89653009 nonsense probably null
IGL02511:Scyl2 APN 10 89640819 missense probably benign
IGL02949:Scyl2 APN 10 89660301 missense possibly damaging 0.82
IGL03087:Scyl2 APN 10 89652968 missense possibly damaging 0.93
IGL03117:Scyl2 APN 10 89657867 missense possibly damaging 0.95
IGL03228:Scyl2 APN 10 89650080 missense probably damaging 1.00
R0019:Scyl2 UTSW 10 89659321 missense probably benign 0.44
R1394:Scyl2 UTSW 10 89640965 missense possibly damaging 0.59
R1460:Scyl2 UTSW 10 89657889 missense possibly damaging 0.90
R1572:Scyl2 UTSW 10 89650956 missense probably damaging 1.00
R1624:Scyl2 UTSW 10 89640736 missense probably benign 0.19
R1909:Scyl2 UTSW 10 89640905 missense probably benign 0.01
R3846:Scyl2 UTSW 10 89640541 missense probably damaging 1.00
R4041:Scyl2 UTSW 10 89650052 missense probably damaging 1.00
R4077:Scyl2 UTSW 10 89640596 missense probably benign 0.01
R4079:Scyl2 UTSW 10 89640596 missense probably benign 0.01
R4765:Scyl2 UTSW 10 89659298 missense probably damaging 0.97
R4855:Scyl2 UTSW 10 89640463 utr 3 prime probably benign
R5308:Scyl2 UTSW 10 89642007 missense probably benign 0.01
R5894:Scyl2 UTSW 10 89640819 missense probably benign
R5901:Scyl2 UTSW 10 89660262 missense probably benign 0.03
R6048:Scyl2 UTSW 10 89645486 missense probably benign 0.33
R6249:Scyl2 UTSW 10 89657857 missense possibly damaging 0.93
R6658:Scyl2 UTSW 10 89640973 missense probably benign 0.01
R6827:Scyl2 UTSW 10 89669804 critical splice acceptor site probably null
R6909:Scyl2 UTSW 10 89645742 missense probably benign 0.28
R7027:Scyl2 UTSW 10 89645461 critical splice donor site probably null
R7095:Scyl2 UTSW 10 89669687 missense probably damaging 1.00
R8062:Scyl2 UTSW 10 89654160 missense probably damaging 0.97
R8095:Scyl2 UTSW 10 89641103 missense probably damaging 1.00
R8197:Scyl2 UTSW 10 89662366 missense probably benign 0.33
R8232:Scyl2 UTSW 10 89662447 missense probably damaging 1.00
R8241:Scyl2 UTSW 10 89654109 missense possibly damaging 0.80
R8263:Scyl2 UTSW 10 89640663 missense possibly damaging 0.50
Z1177:Scyl2 UTSW 10 89669715 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AACCAGCACAGGTAGCCTTAACACA -3'
(R):5'- tgctttttgggtttttcagaggTATTCTAGT -3'

Sequencing Primer
(F):5'- GCATCGTAAGGTTCACATCCG -3'
(R):5'- tccctgctgagctatctttac -3'
Posted On2013-10-16