Incidental Mutation 'R0827:Olfr311'
ID78335
Institutional Source Beutler Lab
Gene Symbol Olfr311
Ensembl Gene ENSMUSG00000094805
Gene Nameolfactory receptor 311
SynonymsMOR222-1, GA_x6K02T2NKPP-565870-564944
MMRRC Submission 039007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R0827 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58839251-58844111 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58841771 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 219 (I219T)
Ref Sequence ENSEMBL: ENSMUSP00000150870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071625] [ENSMUST00000216473]
Predicted Effect probably damaging
Transcript: ENSMUST00000071625
AA Change: I219T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071553
Gene: ENSMUSG00000094805
AA Change: I219T

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 9e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 215 1.7e-8 PFAM
Pfam:7tm_1 39 288 9.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214776
Predicted Effect probably damaging
Transcript: ENSMUST00000216473
AA Change: I219T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1249 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,671 S1397P probably benign Het
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ankk1 A G 9: 49,421,737 I149T possibly damaging Het
Ankrd63 A G 2: 118,702,553 S296P possibly damaging Het
Arpc1b T G 5: 145,125,756 C227G probably benign Het
B4gat1 A G 19: 5,039,697 R241G possibly damaging Het
Ccar2 T C 14: 70,139,838 N751D probably benign Het
Cd55b T C 1: 130,414,236 I221M probably damaging Het
Cntn5 A G 9: 9,666,938 V1032A possibly damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Colec10 G A 15: 54,462,584 C270Y probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cyp2j12 T G 4: 96,112,862 probably benign Het
Dennd5a G A 7: 109,899,731 T999M probably damaging Het
Dusp13 C A 14: 21,742,771 V29L probably benign Het
Efr3a A C 15: 65,853,551 D83A possibly damaging Het
Elmod2 A G 8: 83,316,795 probably null Het
Eml3 C A 19: 8,938,466 T640K probably damaging Het
Eps8l1 T C 7: 4,477,389 V543A possibly damaging Het
Ermn T C 2: 58,048,251 K117E probably damaging Het
F830045P16Rik A G 2: 129,472,776 S194P probably benign Het
Faim2 A G 15: 99,524,736 V60A probably benign Het
Fancd2 G A 6: 113,586,249 probably null Het
Fbxo43 A T 15: 36,162,969 S31T possibly damaging Het
Gab2 G A 7: 97,300,332 R411Q probably damaging Het
Gm17727 A T 9: 35,777,851 L12Q probably damaging Het
Gpm6a A T 8: 55,058,883 D264V probably damaging Het
Hist1h1t A G 13: 23,696,221 D119G probably benign Het
Hsp90aa1 T C 12: 110,692,695 E556G probably benign Het
Ifi203 A T 1: 173,928,463 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnc3 A G 7: 44,595,206 T307A probably damaging Het
Kin C A 2: 10,090,376 probably benign Het
Knl1 T C 2: 119,088,901 probably benign Het
Lrp4 G A 2: 91,495,041 V1404M probably damaging Het
Lrrc71 T A 3: 87,742,645 probably null Het
Med13l T C 5: 118,726,247 probably benign Het
Mfap5 A G 6: 122,520,920 D39G probably damaging Het
Mlxipl T C 5: 135,132,738 S504P probably benign Het
Myo3a T G 2: 22,558,215 Y1D probably damaging Het
Nek1 A G 8: 61,105,648 probably benign Het
Nfkbiz T C 16: 55,816,367 R524G probably damaging Het
Npbwr1 T C 1: 5,916,789 T169A possibly damaging Het
Nuggc T C 14: 65,608,891 Y84H probably damaging Het
Nxph3 G A 11: 95,511,426 S54L probably benign Het
Olfr532 A G 7: 140,419,467 F102S probably damaging Het
Ostn A G 16: 27,324,631 N70D probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pnpla6 A T 8: 3,517,618 M109L possibly damaging Het
Ppil6 T A 10: 41,494,504 probably benign Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Ptprd A T 4: 76,128,915 D371E probably damaging Het
Ripor2 T A 13: 24,694,186 F315I probably damaging Het
Rmi2 G A 16: 10,835,240 G51S probably damaging Het
Scg3 A G 9: 75,683,697 I10T possibly damaging Het
Scn9a T A 2: 66,536,124 K761* probably null Het
Scyl2 A G 10: 89,657,865 L347P possibly damaging Het
Sh3d21 A G 4: 126,152,271 probably benign Het
Shc1 T A 3: 89,426,783 probably null Het
Slbp A G 5: 33,643,822 S182P probably damaging Het
Slc24a1 C T 9: 64,928,190 G885D probably benign Het
Slc24a3 T C 2: 145,518,492 probably benign Het
Sowahb T G 5: 93,043,286 N525H probably damaging Het
Sppl3 T A 5: 115,082,333 C101* probably null Het
Srsf5 A G 12: 80,949,540 K163E probably damaging Het
Sult2a4 A G 7: 13,984,961 I119T probably benign Het
Svep1 A G 4: 58,053,113 probably benign Het
Tas1r3 G A 4: 155,860,869 R632W probably benign Het
Tlr4 T A 4: 66,833,880 probably null Het
Tmf1 A C 6: 97,158,050 L1001* probably null Het
Tnnt2 A G 1: 135,843,796 probably benign Het
Trank1 G A 9: 111,349,417 probably benign Het
Trdn A T 10: 33,399,158 probably benign Het
Trmt6 A T 2: 132,815,834 V34E probably damaging Het
Trrap T C 5: 144,814,830 F1699L probably benign Het
Ttk A G 9: 83,843,915 R250G probably benign Het
Ttn T A 2: 76,809,904 I13787F probably damaging Het
Uggt1 T A 1: 36,156,313 probably null Het
Ugt2b35 T A 5: 87,008,130 probably benign Het
Ugt2b36 C A 5: 87,066,375 R470L possibly damaging Het
Unk A G 11: 116,053,109 D352G possibly damaging Het
Vmn2r77 G T 7: 86,802,016 C370F probably damaging Het
Vmn2r85 A G 10: 130,429,518 I32T possibly damaging Het
Zfp637 A G 6: 117,845,444 I178V possibly damaging Het
Zfp943 A G 17: 21,992,090 probably null Het
Zyg11a A G 4: 108,210,042 probably benign Het
Other mutations in Olfr311
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02367:Olfr311 APN 11 58841512 missense probably benign 0.10
H8786:Olfr311 UTSW 11 58841320 missense probably benign 0.22
R0620:Olfr311 UTSW 11 58841443 missense probably damaging 1.00
R0671:Olfr311 UTSW 11 58841855 missense possibly damaging 0.94
R0839:Olfr311 UTSW 11 58841652 missense probably benign
R0932:Olfr311 UTSW 11 58841714 missense possibly damaging 0.92
R1117:Olfr311 UTSW 11 58841815 missense possibly damaging 0.64
R1533:Olfr311 UTSW 11 58841966 missense probably damaging 1.00
R1540:Olfr311 UTSW 11 58841651 missense probably benign 0.01
R1595:Olfr311 UTSW 11 58841652 missense probably benign
R1826:Olfr311 UTSW 11 58841431 missense probably benign
R2857:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R2858:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R2859:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R3438:Olfr311 UTSW 11 58841872 nonsense probably null
R3765:Olfr311 UTSW 11 58841294 missense probably damaging 1.00
R3831:Olfr311 UTSW 11 58841860 missense probably damaging 0.99
R4858:Olfr311 UTSW 11 58841207 missense possibly damaging 0.86
R5651:Olfr311 UTSW 11 58841491 nonsense probably null
R5979:Olfr311 UTSW 11 58841840 missense probably damaging 1.00
R6316:Olfr311 UTSW 11 58841942 missense probably damaging 1.00
R6717:Olfr311 UTSW 11 58841287 missense probably damaging 1.00
R7163:Olfr311 UTSW 11 58841186 missense probably benign 0.12
R7605:Olfr311 UTSW 11 58841500 missense probably benign 0.00
R8328:Olfr311 UTSW 11 58841634 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGAATGCTTTCTGCTCACGGC -3'
(R):5'- GCTTGTGAATGAAACACTTGGACCC -3'

Sequencing Primer
(F):5'- GCCACAAATATTGTTCTGCATTGG -3'
(R):5'- ACACACTGTAGGCTTCAATGTC -3'
Posted On2013-10-16