Incidental Mutation 'R0827:Srsf5'
ID78338
Institutional Source Beutler Lab
Gene Symbol Srsf5
Ensembl Gene ENSMUSG00000021134
Gene Nameserine/arginine-rich splicing factor 5
SynonymsSfrs5
MMRRC Submission 039007-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock #R0827 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80945504-80950507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80949540 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 163 (K163E)
Ref Sequence ENSEMBL: ENSMUSP00000105985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094693] [ENSMUST00000095572] [ENSMUST00000110351] [ENSMUST00000110352] [ENSMUST00000110354] [ENSMUST00000110356] [ENSMUST00000138434] [ENSMUST00000218162]
Predicted Effect probably damaging
Transcript: ENSMUST00000094693
AA Change: K163E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131323
Gene: ENSMUSG00000021134
AA Change: K163E

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 230 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095572
SMART Domains Protein: ENSMUSP00000093229
Gene: ENSMUSG00000021135

DomainStartEndE-ValueType
Pfam:SBF 32 217 3.3e-47 PFAM
transmembrane domain 222 244 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110351
AA Change: K163E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105980
Gene: ENSMUSG00000021134
AA Change: K163E

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 231 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110352
AA Change: K163E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105981
Gene: ENSMUSG00000021134
AA Change: K163E

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 230 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110354
AA Change: K163E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105983
Gene: ENSMUSG00000021134
AA Change: K163E

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 231 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110356
AA Change: K163E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105985
Gene: ENSMUSG00000021134
AA Change: K163E

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 230 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133783
Predicted Effect probably benign
Transcript: ENSMUST00000138434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219062
Predicted Effect probably benign
Transcript: ENSMUST00000218162
Meta Mutation Damage Score 0.5807 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,671 S1397P probably benign Het
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ankk1 A G 9: 49,421,737 I149T possibly damaging Het
Ankrd63 A G 2: 118,702,553 S296P possibly damaging Het
Arpc1b T G 5: 145,125,756 C227G probably benign Het
B4gat1 A G 19: 5,039,697 R241G possibly damaging Het
Ccar2 T C 14: 70,139,838 N751D probably benign Het
Cd55b T C 1: 130,414,236 I221M probably damaging Het
Cntn5 A G 9: 9,666,938 V1032A possibly damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Colec10 G A 15: 54,462,584 C270Y probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cyp2j12 T G 4: 96,112,862 probably benign Het
Dennd5a G A 7: 109,899,731 T999M probably damaging Het
Dusp13 C A 14: 21,742,771 V29L probably benign Het
Efr3a A C 15: 65,853,551 D83A possibly damaging Het
Elmod2 A G 8: 83,316,795 probably null Het
Eml3 C A 19: 8,938,466 T640K probably damaging Het
Eps8l1 T C 7: 4,477,389 V543A possibly damaging Het
Ermn T C 2: 58,048,251 K117E probably damaging Het
F830045P16Rik A G 2: 129,472,776 S194P probably benign Het
Faim2 A G 15: 99,524,736 V60A probably benign Het
Fancd2 G A 6: 113,586,249 probably null Het
Fbxo43 A T 15: 36,162,969 S31T possibly damaging Het
Gab2 G A 7: 97,300,332 R411Q probably damaging Het
Gm17727 A T 9: 35,777,851 L12Q probably damaging Het
Gpm6a A T 8: 55,058,883 D264V probably damaging Het
Hist1h1t A G 13: 23,696,221 D119G probably benign Het
Hsp90aa1 T C 12: 110,692,695 E556G probably benign Het
Ifi203 A T 1: 173,928,463 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnc3 A G 7: 44,595,206 T307A probably damaging Het
Kin C A 2: 10,090,376 probably benign Het
Knl1 T C 2: 119,088,901 probably benign Het
Lrp4 G A 2: 91,495,041 V1404M probably damaging Het
Lrrc71 T A 3: 87,742,645 probably null Het
Med13l T C 5: 118,726,247 probably benign Het
Mfap5 A G 6: 122,520,920 D39G probably damaging Het
Mlxipl T C 5: 135,132,738 S504P probably benign Het
Myo3a T G 2: 22,558,215 Y1D probably damaging Het
Nek1 A G 8: 61,105,648 probably benign Het
Nfkbiz T C 16: 55,816,367 R524G probably damaging Het
Npbwr1 T C 1: 5,916,789 T169A possibly damaging Het
Nuggc T C 14: 65,608,891 Y84H probably damaging Het
Nxph3 G A 11: 95,511,426 S54L probably benign Het
Olfr311 T C 11: 58,841,771 I219T probably damaging Het
Olfr532 A G 7: 140,419,467 F102S probably damaging Het
Ostn A G 16: 27,324,631 N70D probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pnpla6 A T 8: 3,517,618 M109L possibly damaging Het
Ppil6 T A 10: 41,494,504 probably benign Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Ptprd A T 4: 76,128,915 D371E probably damaging Het
Ripor2 T A 13: 24,694,186 F315I probably damaging Het
Rmi2 G A 16: 10,835,240 G51S probably damaging Het
Scg3 A G 9: 75,683,697 I10T possibly damaging Het
Scn9a T A 2: 66,536,124 K761* probably null Het
Scyl2 A G 10: 89,657,865 L347P possibly damaging Het
Sh3d21 A G 4: 126,152,271 probably benign Het
Shc1 T A 3: 89,426,783 probably null Het
Slbp A G 5: 33,643,822 S182P probably damaging Het
Slc24a1 C T 9: 64,928,190 G885D probably benign Het
Slc24a3 T C 2: 145,518,492 probably benign Het
Sowahb T G 5: 93,043,286 N525H probably damaging Het
Sppl3 T A 5: 115,082,333 C101* probably null Het
Sult2a4 A G 7: 13,984,961 I119T probably benign Het
Svep1 A G 4: 58,053,113 probably benign Het
Tas1r3 G A 4: 155,860,869 R632W probably benign Het
Tlr4 T A 4: 66,833,880 probably null Het
Tmf1 A C 6: 97,158,050 L1001* probably null Het
Tnnt2 A G 1: 135,843,796 probably benign Het
Trank1 G A 9: 111,349,417 probably benign Het
Trdn A T 10: 33,399,158 probably benign Het
Trmt6 A T 2: 132,815,834 V34E probably damaging Het
Trrap T C 5: 144,814,830 F1699L probably benign Het
Ttk A G 9: 83,843,915 R250G probably benign Het
Ttn T A 2: 76,809,904 I13787F probably damaging Het
Uggt1 T A 1: 36,156,313 probably null Het
Ugt2b35 T A 5: 87,008,130 probably benign Het
Ugt2b36 C A 5: 87,066,375 R470L possibly damaging Het
Unk A G 11: 116,053,109 D352G possibly damaging Het
Vmn2r77 G T 7: 86,802,016 C370F probably damaging Het
Vmn2r85 A G 10: 130,429,518 I32T possibly damaging Het
Zfp637 A G 6: 117,845,444 I178V possibly damaging Het
Zfp943 A G 17: 21,992,090 probably null Het
Zyg11a A G 4: 108,210,042 probably benign Het
Other mutations in Srsf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Srsf5 APN 12 80947834 missense probably damaging 1.00
R0344:Srsf5 UTSW 12 80947524 missense probably benign 0.00
R1552:Srsf5 UTSW 12 80949745 unclassified probably benign
R2519:Srsf5 UTSW 12 80949096 missense probably damaging 0.99
R4926:Srsf5 UTSW 12 80947301 utr 3 prime probably benign
R5505:Srsf5 UTSW 12 80949083 unclassified probably benign
R5786:Srsf5 UTSW 12 80949537 missense possibly damaging 0.48
R7810:Srsf5 UTSW 12 80949946 missense unknown
R8265:Srsf5 UTSW 12 80947336 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCGGATGCACATCGACCTAAAC -3'
(R):5'- GTGACCTGCTTCTTGACCTGCTATG -3'

Sequencing Primer
(F):5'- GACTGTTGATAATAGGCACCTGC -3'
(R):5'- TGACCTGCTATGAAAAATTGGCAAG -3'
Posted On2013-10-16