Incidental Mutation 'R0827:Eml3'
ID78353
Institutional Source Beutler Lab
Gene Symbol Eml3
Ensembl Gene ENSMUSG00000071647
Gene Nameechinoderm microtubule associated protein like 3
Synonyms
MMRRC Submission 039007-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.817) question?
Stock #R0827 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8929552-8941582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8938466 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 640 (T640K)
Ref Sequence ENSEMBL: ENSMUSP00000153500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096240] [ENSMUST00000096241] [ENSMUST00000224272] [ENSMUST00000224642]
Predicted Effect probably benign
Transcript: ENSMUST00000096240
SMART Domains Protein: ENSMUSP00000093959
Gene: ENSMUSG00000071646

DomainStartEndE-ValueType
BAH 4 144 7.34e-34 SMART
ELM2 147 201 5.58e-15 SMART
SANT 264 313 2.24e-7 SMART
ZnF_GATA 361 415 5.5e-15 SMART
low complexity region 475 490 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000096241
AA Change: T641K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093960
Gene: ENSMUSG00000071647
AA Change: T641K

DomainStartEndE-ValueType
coiled coil region 12 47 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 118 139 N/A INTRINSIC
low complexity region 149 168 N/A INTRINSIC
low complexity region 198 208 N/A INTRINSIC
Pfam:HELP 215 286 5.3e-30 PFAM
WD40 295 344 6.34e-2 SMART
Blast:WD40 347 392 5e-22 BLAST
WD40 395 434 1.56e-1 SMART
WD40 450 487 2.64e2 SMART
WD40 504 543 3.33e-1 SMART
WD40 587 626 2.69e-5 SMART
WD40 670 709 1.7e-2 SMART
WD40 716 755 1.52e-4 SMART
WD40 829 869 1.29e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137956
Predicted Effect probably damaging
Transcript: ENSMUST00000224272
AA Change: T640K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000224642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226096
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,671 S1397P probably benign Het
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ankk1 A G 9: 49,421,737 I149T possibly damaging Het
Ankrd63 A G 2: 118,702,553 S296P possibly damaging Het
Arpc1b T G 5: 145,125,756 C227G probably benign Het
B4gat1 A G 19: 5,039,697 R241G possibly damaging Het
Ccar2 T C 14: 70,139,838 N751D probably benign Het
Cd55b T C 1: 130,414,236 I221M probably damaging Het
Cntn5 A G 9: 9,666,938 V1032A possibly damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Colec10 G A 15: 54,462,584 C270Y probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cyp2j12 T G 4: 96,112,862 probably benign Het
Dennd5a G A 7: 109,899,731 T999M probably damaging Het
Dusp13 C A 14: 21,742,771 V29L probably benign Het
Efr3a A C 15: 65,853,551 D83A possibly damaging Het
Elmod2 A G 8: 83,316,795 probably null Het
Eps8l1 T C 7: 4,477,389 V543A possibly damaging Het
Ermn T C 2: 58,048,251 K117E probably damaging Het
F830045P16Rik A G 2: 129,472,776 S194P probably benign Het
Faim2 A G 15: 99,524,736 V60A probably benign Het
Fancd2 G A 6: 113,586,249 probably null Het
Fbxo43 A T 15: 36,162,969 S31T possibly damaging Het
Gab2 G A 7: 97,300,332 R411Q probably damaging Het
Gm17727 A T 9: 35,777,851 L12Q probably damaging Het
Gpm6a A T 8: 55,058,883 D264V probably damaging Het
Hist1h1t A G 13: 23,696,221 D119G probably benign Het
Hsp90aa1 T C 12: 110,692,695 E556G probably benign Het
Ifi203 A T 1: 173,928,463 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnc3 A G 7: 44,595,206 T307A probably damaging Het
Kin C A 2: 10,090,376 probably benign Het
Knl1 T C 2: 119,088,901 probably benign Het
Lrp4 G A 2: 91,495,041 V1404M probably damaging Het
Lrrc71 T A 3: 87,742,645 probably null Het
Med13l T C 5: 118,726,247 probably benign Het
Mfap5 A G 6: 122,520,920 D39G probably damaging Het
Mlxipl T C 5: 135,132,738 S504P probably benign Het
Myo3a T G 2: 22,558,215 Y1D probably damaging Het
Nek1 A G 8: 61,105,648 probably benign Het
Nfkbiz T C 16: 55,816,367 R524G probably damaging Het
Npbwr1 T C 1: 5,916,789 T169A possibly damaging Het
Nuggc T C 14: 65,608,891 Y84H probably damaging Het
Nxph3 G A 11: 95,511,426 S54L probably benign Het
Olfr311 T C 11: 58,841,771 I219T probably damaging Het
Olfr532 A G 7: 140,419,467 F102S probably damaging Het
Ostn A G 16: 27,324,631 N70D probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pnpla6 A T 8: 3,517,618 M109L possibly damaging Het
Ppil6 T A 10: 41,494,504 probably benign Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Ptprd A T 4: 76,128,915 D371E probably damaging Het
Ripor2 T A 13: 24,694,186 F315I probably damaging Het
Rmi2 G A 16: 10,835,240 G51S probably damaging Het
Scg3 A G 9: 75,683,697 I10T possibly damaging Het
Scn9a T A 2: 66,536,124 K761* probably null Het
Scyl2 A G 10: 89,657,865 L347P possibly damaging Het
Sh3d21 A G 4: 126,152,271 probably benign Het
Shc1 T A 3: 89,426,783 probably null Het
Slbp A G 5: 33,643,822 S182P probably damaging Het
Slc24a1 C T 9: 64,928,190 G885D probably benign Het
Slc24a3 T C 2: 145,518,492 probably benign Het
Sowahb T G 5: 93,043,286 N525H probably damaging Het
Sppl3 T A 5: 115,082,333 C101* probably null Het
Srsf5 A G 12: 80,949,540 K163E probably damaging Het
Sult2a4 A G 7: 13,984,961 I119T probably benign Het
Svep1 A G 4: 58,053,113 probably benign Het
Tas1r3 G A 4: 155,860,869 R632W probably benign Het
Tlr4 T A 4: 66,833,880 probably null Het
Tmf1 A C 6: 97,158,050 L1001* probably null Het
Tnnt2 A G 1: 135,843,796 probably benign Het
Trank1 G A 9: 111,349,417 probably benign Het
Trdn A T 10: 33,399,158 probably benign Het
Trmt6 A T 2: 132,815,834 V34E probably damaging Het
Trrap T C 5: 144,814,830 F1699L probably benign Het
Ttk A G 9: 83,843,915 R250G probably benign Het
Ttn T A 2: 76,809,904 I13787F probably damaging Het
Uggt1 T A 1: 36,156,313 probably null Het
Ugt2b35 T A 5: 87,008,130 probably benign Het
Ugt2b36 C A 5: 87,066,375 R470L possibly damaging Het
Unk A G 11: 116,053,109 D352G possibly damaging Het
Vmn2r77 G T 7: 86,802,016 C370F probably damaging Het
Vmn2r85 A G 10: 130,429,518 I32T possibly damaging Het
Zfp637 A G 6: 117,845,444 I178V possibly damaging Het
Zfp943 A G 17: 21,992,090 probably null Het
Zyg11a A G 4: 108,210,042 probably benign Het
Other mutations in Eml3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Eml3 APN 19 8936398 nonsense probably null
IGL01398:Eml3 APN 19 8934234 splice site probably benign
IGL01904:Eml3 APN 19 8936766 splice site probably benign
IGL02557:Eml3 APN 19 8931381 unclassified probably benign
IGL02795:Eml3 APN 19 8933778 missense probably benign 0.43
IGL03160:Eml3 APN 19 8934955 missense probably benign 0.04
IGL03172:Eml3 APN 19 8939179 unclassified probably benign
IGL03376:Eml3 APN 19 8933790 missense probably damaging 1.00
R0063:Eml3 UTSW 19 8938478 missense probably damaging 1.00
R0063:Eml3 UTSW 19 8938478 missense probably damaging 1.00
R0097:Eml3 UTSW 19 8936651 missense probably benign 0.32
R0097:Eml3 UTSW 19 8936651 missense probably benign 0.32
R0599:Eml3 UTSW 19 8939063 missense probably benign 0.14
R0652:Eml3 UTSW 19 8933285 missense probably damaging 1.00
R0841:Eml3 UTSW 19 8937685 missense probably benign
R0880:Eml3 UTSW 19 8940915 missense possibly damaging 0.92
R0924:Eml3 UTSW 19 8933311 critical splice donor site probably null
R1127:Eml3 UTSW 19 8936308 missense probably damaging 0.99
R1156:Eml3 UTSW 19 8934130 missense probably damaging 1.00
R1160:Eml3 UTSW 19 8933250 missense probably benign 0.00
R1427:Eml3 UTSW 19 8933861 missense probably damaging 1.00
R1497:Eml3 UTSW 19 8936369 missense probably damaging 1.00
R1679:Eml3 UTSW 19 8936637 missense probably damaging 0.98
R1931:Eml3 UTSW 19 8937143 missense probably benign 0.43
R2119:Eml3 UTSW 19 8934354 critical splice donor site probably null
R4296:Eml3 UTSW 19 8931409 missense probably damaging 1.00
R5122:Eml3 UTSW 19 8937696 critical splice donor site probably null
R5288:Eml3 UTSW 19 8939274 missense probably damaging 1.00
R5467:Eml3 UTSW 19 8937582 nonsense probably null
R5836:Eml3 UTSW 19 8941295 missense possibly damaging 0.96
R5845:Eml3 UTSW 19 8939218 missense probably damaging 1.00
R5879:Eml3 UTSW 19 8935015 missense possibly damaging 0.77
R5881:Eml3 UTSW 19 8933443 missense probably damaging 1.00
R6011:Eml3 UTSW 19 8939107 missense probably damaging 1.00
R6247:Eml3 UTSW 19 8930949 missense probably benign
R6777:Eml3 UTSW 19 8936722 missense probably benign
R7132:Eml3 UTSW 19 8941028 missense probably benign 0.25
R7169:Eml3 UTSW 19 8933464 missense probably damaging 1.00
R7896:Eml3 UTSW 19 8933807 missense possibly damaging 0.96
R8054:Eml3 UTSW 19 8939050 missense possibly damaging 0.77
R8354:Eml3 UTSW 19 8934994 missense probably damaging 1.00
R8361:Eml3 UTSW 19 8937437 missense possibly damaging 0.94
X0025:Eml3 UTSW 19 8937439 missense probably damaging 0.96
Z1177:Eml3 UTSW 19 8937561 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTAGGCTCTATCCCAGGTCTCTCA -3'
(R):5'- GCACCCGAAAGGTGTGGTTCAA -3'

Sequencing Primer
(F):5'- actcagaaatccacctgcc -3'
(R):5'- AACACTTTAGTTAGCCTTGGTCAC -3'
Posted On2013-10-16