Incidental Mutation 'R0828:Camsap1'
ID78359
Institutional Source Beutler Lab
Gene Symbol Camsap1
Ensembl Gene ENSMUSG00000026933
Gene Namecalmodulin regulated spectrin-associated protein 1
Synonyms9530003A05Rik, PRO2405
MMRRC Submission 039008-MU
Accession Numbers

Genbank: NM_001115076; MGI: 3036242

Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R0828 (G1)
Quality Score221
Status Validated
Chromosome2
Chromosomal Location25926838-25983282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25939085 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 876 (Q876K)
Ref Sequence ENSEMBL: ENSMUSP00000109804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091268] [ENSMUST00000114167] [ENSMUST00000134882] [ENSMUST00000183461]
Predicted Effect probably damaging
Transcript: ENSMUST00000091268
AA Change: Q876K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088812
Gene: ENSMUSG00000026933
AA Change: Q876K

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 228 311 3.3e-35 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
Pfam:CAMSAP_CC1 859 917 3.8e-29 PFAM
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114167
AA Change: Q876K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109804
Gene: ENSMUSG00000026933
AA Change: Q876K

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134882
AA Change: Q896K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117203
Gene: ENSMUSG00000026933
AA Change: Q896K

DomainStartEndE-ValueType
Pfam:CH 185 350 1.3e-33 PFAM
Pfam:CAMSAP_CH 248 331 2.6e-34 PFAM
low complexity region 752 767 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
coiled coil region 889 925 N/A INTRINSIC
coiled coil region 1030 1057 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134970
Predicted Effect probably benign
Transcript: ENSMUST00000143977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148146
Predicted Effect probably damaging
Transcript: ENSMUST00000183461
AA Change: Q876K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139028
Gene: ENSMUSG00000026933
AA Change: Q876K

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Meta Mutation Damage Score 0.1573 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 98% (59/60)
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A G 16: 13,677,805 Y256C probably damaging Het
5730522E02Rik C T 11: 25,652,020 C70Y unknown Het
Abi3bp C T 16: 56,677,830 T929I probably damaging Het
Adap2 C A 11: 80,165,664 probably benign Het
Adgrg5 A G 8: 94,941,785 probably null Het
Afdn C A 17: 13,903,998 N1803K probably damaging Het
Alox12b T C 11: 69,166,306 L451P possibly damaging Het
Ankrd26 T C 6: 118,533,473 probably benign Het
Bcr A T 10: 75,157,207 probably benign Het
Cacna1c T C 6: 118,757,386 N300D probably benign Het
Cdh10 A G 15: 18,986,751 D356G possibly damaging Het
Cdipt T A 7: 126,976,920 Y16N probably damaging Het
Cebpz T C 17: 78,925,982 E772G probably benign Het
Cep350 A G 1: 155,953,246 I304T probably benign Het
Chpt1 C A 10: 88,476,415 G9V probably damaging Het
Col6a5 T A 9: 105,862,064 probably null Het
Dock7 G T 4: 99,015,745 P688T probably damaging Het
Ephb3 T A 16: 21,219,034 probably benign Het
Fcgr2b T C 1: 170,961,030 Y336C probably damaging Het
Flg2 A T 3: 93,203,332 H889L unknown Het
Gucy2c C T 6: 136,709,748 V806M probably damaging Het
Hmgxb3 T A 18: 61,171,354 I55F probably damaging Het
Igsf9b T A 9: 27,319,605 Y301* probably null Het
Il12rb2 C T 6: 67,356,707 R196H probably benign Het
Itgam T C 7: 128,116,505 probably null Het
Klhl25 T C 7: 75,866,195 V283A probably damaging Het
Klhl5 T C 5: 65,162,792 L423P probably damaging Het
Krt6a T C 15: 101,693,836 N138S probably damaging Het
Lrba A T 3: 86,608,370 probably null Het
Map4k5 T C 12: 69,805,326 T828A probably damaging Het
March8 T A 6: 116,405,678 M434K probably benign Het
Mink1 C T 11: 70,610,145 Q743* probably null Het
Mrgpra3 T C 7: 47,590,136 N14S probably benign Het
Mroh7 T C 4: 106,699,876 S808G probably damaging Het
Msi1 T C 5: 115,430,894 probably null Het
Nrap A G 19: 56,345,558 Y874H probably damaging Het
Nup205 T C 6: 35,194,566 F455L probably benign Het
Olfr31 G T 14: 14,328,800 V230L probably benign Het
Piwil2 A G 14: 70,376,017 V894A probably damaging Het
Polr1c A G 17: 46,245,064 S173P probably damaging Het
Prep C T 10: 45,155,525 A564V probably benign Het
Rab3gap1 T C 1: 127,938,185 probably benign Het
Rcc1 G C 4: 132,335,825 probably benign Het
Scn11a T A 9: 119,755,007 D1514V probably benign Het
Setdb1 G A 3: 95,338,860 P584S probably damaging Het
Slc12a7 A G 13: 73,788,652 I144V probably benign Het
Slc45a4 T C 15: 73,586,816 M295V probably benign Het
Slco1a1 T A 6: 141,921,839 D456V possibly damaging Het
Sspo G T 6: 48,498,734 C4928F probably damaging Het
St6galnac1 T A 11: 116,768,997 K163N probably benign Het
Tcp11l1 A T 2: 104,699,836 probably benign Het
Tns1 T A 1: 73,919,666 I1715F probably damaging Het
Trpa1 C T 1: 14,875,884 V1008M probably damaging Het
Ttc28 A G 5: 111,223,446 E587G probably damaging Het
Ubr4 T C 4: 139,450,553 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp8 G A 2: 126,742,114 probably benign Het
Zfc3h1 G T 10: 115,401,707 A464S possibly damaging Het
Zfp106 T C 2: 120,535,603 I108V probably benign Het
Other mutations in Camsap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Camsap1 APN 2 25933623 missense possibly damaging 0.95
IGL01555:Camsap1 APN 2 25939393 missense possibly damaging 0.81
IGL01667:Camsap1 APN 2 25945281 splice site probably benign
IGL02167:Camsap1 APN 2 25934300 missense probably damaging 1.00
IGL02191:Camsap1 APN 2 25929880 missense probably damaging 0.97
IGL02285:Camsap1 APN 2 25929802 missense probably damaging 1.00
IGL02393:Camsap1 APN 2 25938322 missense probably benign 0.10
3-1:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R0631:Camsap1 UTSW 2 25933647 missense probably damaging 0.98
R1434:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R1687:Camsap1 UTSW 2 25939615 missense probably damaging 1.00
R2027:Camsap1 UTSW 2 25938526 missense possibly damaging 0.51
R2048:Camsap1 UTSW 2 25929743 missense probably benign 0.00
R3732:Camsap1 UTSW 2 25938344 missense probably damaging 1.00
R4437:Camsap1 UTSW 2 25938646 missense possibly damaging 0.89
R4494:Camsap1 UTSW 2 25952758 missense probably damaging 1.00
R4888:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5028:Camsap1 UTSW 2 25944556 missense probably damaging 1.00
R5058:Camsap1 UTSW 2 25939363 missense probably benign 0.01
R5105:Camsap1 UTSW 2 25940929 missense probably damaging 1.00
R5121:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5153:Camsap1 UTSW 2 25933618 missense probably damaging 1.00
R5323:Camsap1 UTSW 2 25965811 missense probably damaging 0.98
R6043:Camsap1 UTSW 2 25929925 missense probably benign 0.00
R6479:Camsap1 UTSW 2 25935862 missense possibly damaging 0.88
R6502:Camsap1 UTSW 2 25956308 missense probably damaging 1.00
R6571:Camsap1 UTSW 2 25939500 missense possibly damaging 0.89
R7046:Camsap1 UTSW 2 25945189 missense probably damaging 0.99
R7251:Camsap1 UTSW 2 25938886 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTCTCTCCATCATGCAGAGCAG -3'
(R):5'- ACTTCTCAGCTCAGCAGCATGTC -3'

Sequencing Primer
(F):5'- GCTTATGTAGCTGGACAAATGCC -3'
(R):5'- CTTTGCTGAAAGGAAGCTCC -3'
Posted On2013-10-16