Incidental Mutation 'R0828:Ankrd26'
ID78377
Institutional Source Beutler Lab
Gene Symbol Ankrd26
Ensembl Gene ENSMUSG00000007827
Gene Nameankyrin repeat domain 26
Synonyms5730521P14Rik
MMRRC Submission 039008-MU
Accession Numbers

Genbank: NM_001081112;MGI: 1917887

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0828 (G1)
Quality Score183
Status Validated
Chromosome6
Chromosomal Location118501308-118562226 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 118533473 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112830]
Predicted Effect probably benign
Transcript: ENSMUST00000112830
SMART Domains Protein: ENSMUSP00000108449
Gene: ENSMUSG00000007827

DomainStartEndE-ValueType
ANK 80 109 1.5e-7 SMART
ANK 113 142 3.5e-4 SMART
ANK 146 175 1.9e-6 SMART
ANK 179 208 2.2e-4 SMART
low complexity region 306 316 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Blast:BRLZ 692 754 4e-10 BLAST
Pfam:CCDC144C 886 1190 2e-142 PFAM
low complexity region 1298 1315 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
coiled coil region 1407 1444 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
Pfam:DUF3496 1495 1602 1.3e-47 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing N-terminal ankyrin repeats which function in protein-protein interactions. Mutations in this gene are associated with autosomal dominant thrombocytopenia-2. Pseudogenes of this gene are found on chromosome 7, 10, 13 and 16. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele have enlarged kidneys and hearts, exhibit increased lean body mass and adiposity, develop extreme obesity associated with hyperphagia rather than reduced energy expenditure, and show insulin resistance and gigantism. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A G 16: 13,677,805 Y256C probably damaging Het
5730522E02Rik C T 11: 25,652,020 C70Y unknown Het
Abi3bp C T 16: 56,677,830 T929I probably damaging Het
Adap2 C A 11: 80,165,664 probably benign Het
Adgrg5 A G 8: 94,941,785 probably null Het
Afdn C A 17: 13,903,998 N1803K probably damaging Het
Alox12b T C 11: 69,166,306 L451P possibly damaging Het
Bcr A T 10: 75,157,207 probably benign Het
Cacna1c T C 6: 118,757,386 N300D probably benign Het
Camsap1 G T 2: 25,939,085 Q876K probably damaging Het
Cdh10 A G 15: 18,986,751 D356G possibly damaging Het
Cdipt T A 7: 126,976,920 Y16N probably damaging Het
Cebpz T C 17: 78,925,982 E772G probably benign Het
Cep350 A G 1: 155,953,246 I304T probably benign Het
Chpt1 C A 10: 88,476,415 G9V probably damaging Het
Col6a5 T A 9: 105,862,064 probably null Het
Dock7 G T 4: 99,015,745 P688T probably damaging Het
Ephb3 T A 16: 21,219,034 probably benign Het
Fcgr2b T C 1: 170,961,030 Y336C probably damaging Het
Flg2 A T 3: 93,203,332 H889L unknown Het
Gucy2c C T 6: 136,709,748 V806M probably damaging Het
Hmgxb3 T A 18: 61,171,354 I55F probably damaging Het
Igsf9b T A 9: 27,319,605 Y301* probably null Het
Il12rb2 C T 6: 67,356,707 R196H probably benign Het
Itgam T C 7: 128,116,505 probably null Het
Klhl25 T C 7: 75,866,195 V283A probably damaging Het
Klhl5 T C 5: 65,162,792 L423P probably damaging Het
Krt6a T C 15: 101,693,836 N138S probably damaging Het
Lrba A T 3: 86,608,370 probably null Het
Map4k5 T C 12: 69,805,326 T828A probably damaging Het
March8 T A 6: 116,405,678 M434K probably benign Het
Mink1 C T 11: 70,610,145 Q743* probably null Het
Mrgpra3 T C 7: 47,590,136 N14S probably benign Het
Mroh7 T C 4: 106,699,876 S808G probably damaging Het
Msi1 T C 5: 115,430,894 probably null Het
Nrap A G 19: 56,345,558 Y874H probably damaging Het
Nup205 T C 6: 35,194,566 F455L probably benign Het
Olfr31 G T 14: 14,328,800 V230L probably benign Het
Piwil2 A G 14: 70,376,017 V894A probably damaging Het
Polr1c A G 17: 46,245,064 S173P probably damaging Het
Prep C T 10: 45,155,525 A564V probably benign Het
Rab3gap1 T C 1: 127,938,185 probably benign Het
Rcc1 G C 4: 132,335,825 probably benign Het
Scn11a T A 9: 119,755,007 D1514V probably benign Het
Setdb1 G A 3: 95,338,860 P584S probably damaging Het
Slc12a7 A G 13: 73,788,652 I144V probably benign Het
Slc45a4 T C 15: 73,586,816 M295V probably benign Het
Slco1a1 T A 6: 141,921,839 D456V possibly damaging Het
Sspo G T 6: 48,498,734 C4928F probably damaging Het
St6galnac1 T A 11: 116,768,997 K163N probably benign Het
Tcp11l1 A T 2: 104,699,836 probably benign Het
Tns1 T A 1: 73,919,666 I1715F probably damaging Het
Trpa1 C T 1: 14,875,884 V1008M probably damaging Het
Ttc28 A G 5: 111,223,446 E587G probably damaging Het
Ubr4 T C 4: 139,450,553 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp8 G A 2: 126,742,114 probably benign Het
Zfc3h1 G T 10: 115,401,707 A464S possibly damaging Het
Zfp106 T C 2: 120,535,603 I108V probably benign Het
Other mutations in Ankrd26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ankrd26 APN 6 118559358 nonsense probably null
IGL01286:Ankrd26 APN 6 118559107 missense probably damaging 1.00
IGL01574:Ankrd26 APN 6 118539698 missense probably damaging 1.00
IGL01727:Ankrd26 APN 6 118511636 missense probably damaging 1.00
IGL01954:Ankrd26 APN 6 118559005 missense possibly damaging 0.62
IGL02200:Ankrd26 APN 6 118559341 missense probably damaging 1.00
IGL02708:Ankrd26 APN 6 118518418 splice site probably benign
IGL02973:Ankrd26 APN 6 118523550 missense probably damaging 0.98
IGL03233:Ankrd26 APN 6 118535146 splice site probably null
ANU74:Ankrd26 UTSW 6 118552775 missense probably benign 0.02
N/A:Ankrd26 UTSW 6 118529574 missense probably benign 0.04
R0078:Ankrd26 UTSW 6 118535069 splice site probably benign
R0083:Ankrd26 UTSW 6 118523254 missense probably benign 0.36
R0165:Ankrd26 UTSW 6 118540484 missense probably benign 0.01
R0344:Ankrd26 UTSW 6 118507637 critical splice donor site probably null
R1532:Ankrd26 UTSW 6 118522958 missense probably damaging 1.00
R1809:Ankrd26 UTSW 6 118525922 splice site probably benign
R1875:Ankrd26 UTSW 6 118540449 critical splice donor site probably null
R1940:Ankrd26 UTSW 6 118511693 missense probably damaging 1.00
R2164:Ankrd26 UTSW 6 118525791 missense probably damaging 1.00
R2202:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R2204:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R2205:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R3107:Ankrd26 UTSW 6 118556243 missense probably benign 0.01
R3419:Ankrd26 UTSW 6 118535107 missense probably damaging 1.00
R3552:Ankrd26 UTSW 6 118507776 missense probably damaging 1.00
R3899:Ankrd26 UTSW 6 118549428 missense probably benign 0.30
R4157:Ankrd26 UTSW 6 118507821 missense probably damaging 1.00
R4194:Ankrd26 UTSW 6 118523678 missense probably benign 0.21
R4230:Ankrd26 UTSW 6 118559388 splice site probably null
R4651:Ankrd26 UTSW 6 118515826 missense probably benign 0.03
R4701:Ankrd26 UTSW 6 118506485 missense possibly damaging 0.65
R4747:Ankrd26 UTSW 6 118527757 missense probably benign 0.01
R4752:Ankrd26 UTSW 6 118540465 missense probably null 1.00
R4834:Ankrd26 UTSW 6 118523718 missense probably benign 0.08
R4835:Ankrd26 UTSW 6 118548850 nonsense probably null
R4849:Ankrd26 UTSW 6 118532296 missense probably benign 0.00
R5149:Ankrd26 UTSW 6 118558996 missense probably benign 0.05
R5389:Ankrd26 UTSW 6 118508575 missense possibly damaging 0.82
R5473:Ankrd26 UTSW 6 118515836 missense probably benign 0.04
R5518:Ankrd26 UTSW 6 118548908 missense probably benign 0.00
R5525:Ankrd26 UTSW 6 118527731 missense probably benign 0.00
R5608:Ankrd26 UTSW 6 118511622 missense probably damaging 1.00
R5639:Ankrd26 UTSW 6 118539724 missense possibly damaging 0.72
R5704:Ankrd26 UTSW 6 118523882 missense probably damaging 0.96
R5927:Ankrd26 UTSW 6 118507636 critical splice donor site probably null
R5943:Ankrd26 UTSW 6 118505746 missense probably damaging 1.00
R5976:Ankrd26 UTSW 6 118517894 critical splice donor site probably null
R6181:Ankrd26 UTSW 6 118548877 missense probably benign 0.15
R6478:Ankrd26 UTSW 6 118511638 missense probably benign 0.28
R6667:Ankrd26 UTSW 6 118507788 missense probably benign 0.02
R6865:Ankrd26 UTSW 6 118523481 missense possibly damaging 0.90
R7224:Ankrd26 UTSW 6 118539727 missense probably benign 0.07
R7287:Ankrd26 UTSW 6 118549637 critical splice donor site probably null
R7301:Ankrd26 UTSW 6 118511663 missense possibly damaging 0.62
R7348:Ankrd26 UTSW 6 118508564 missense probably damaging 1.00
R7414:Ankrd26 UTSW 6 118508780 missense possibly damaging 0.60
R7789:Ankrd26 UTSW 6 118527798 missense probably damaging 0.98
R7789:Ankrd26 UTSW 6 118527799 missense possibly damaging 0.82
X0028:Ankrd26 UTSW 6 118507761 missense probably damaging 1.00
Z1177:Ankrd26 UTSW 6 118523532 missense possibly damaging 0.77
Z1177:Ankrd26 UTSW 6 118523595 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTAAATATTGCCCACTCTTACCTGCCA -3'
(R):5'- TCGAGTGTCAAACGCAAATCCTGG -3'

Sequencing Primer
(F):5'- ACTCTTACCTGCCACGTCC -3'
(R):5'- cctacagaggtcggaggag -3'
Posted On2013-10-16