Incidental Mutation 'R0828:Scn11a'
ID78389
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
MMRRC Submission 039008-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0828 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119755007 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1514 (D1514V)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably benign
Transcript: ENSMUST00000070617
AA Change: D1514V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: D1514V

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215718
AA Change: D1514V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A G 16: 13,677,805 Y256C probably damaging Het
5730522E02Rik C T 11: 25,652,020 C70Y unknown Het
Abi3bp C T 16: 56,677,830 T929I probably damaging Het
Adap2 C A 11: 80,165,664 probably benign Het
Adgrg5 A G 8: 94,941,785 probably null Het
Afdn C A 17: 13,903,998 N1803K probably damaging Het
Alox12b T C 11: 69,166,306 L451P possibly damaging Het
Ankrd26 T C 6: 118,533,473 probably benign Het
Bcr A T 10: 75,157,207 probably benign Het
Cacna1c T C 6: 118,757,386 N300D probably benign Het
Camsap1 G T 2: 25,939,085 Q876K probably damaging Het
Cdh10 A G 15: 18,986,751 D356G possibly damaging Het
Cdipt T A 7: 126,976,920 Y16N probably damaging Het
Cebpz T C 17: 78,925,982 E772G probably benign Het
Cep350 A G 1: 155,953,246 I304T probably benign Het
Chpt1 C A 10: 88,476,415 G9V probably damaging Het
Col6a5 T A 9: 105,862,064 probably null Het
Dock7 G T 4: 99,015,745 P688T probably damaging Het
Ephb3 T A 16: 21,219,034 probably benign Het
Fcgr2b T C 1: 170,961,030 Y336C probably damaging Het
Flg2 A T 3: 93,203,332 H889L unknown Het
Gucy2c C T 6: 136,709,748 V806M probably damaging Het
Hmgxb3 T A 18: 61,171,354 I55F probably damaging Het
Igsf9b T A 9: 27,319,605 Y301* probably null Het
Il12rb2 C T 6: 67,356,707 R196H probably benign Het
Itgam T C 7: 128,116,505 probably null Het
Klhl25 T C 7: 75,866,195 V283A probably damaging Het
Klhl5 T C 5: 65,162,792 L423P probably damaging Het
Krt6a T C 15: 101,693,836 N138S probably damaging Het
Lrba A T 3: 86,608,370 probably null Het
Map4k5 T C 12: 69,805,326 T828A probably damaging Het
March8 T A 6: 116,405,678 M434K probably benign Het
Mink1 C T 11: 70,610,145 Q743* probably null Het
Mrgpra3 T C 7: 47,590,136 N14S probably benign Het
Mroh7 T C 4: 106,699,876 S808G probably damaging Het
Msi1 T C 5: 115,430,894 probably null Het
Nrap A G 19: 56,345,558 Y874H probably damaging Het
Nup205 T C 6: 35,194,566 F455L probably benign Het
Olfr31 G T 14: 14,328,800 V230L probably benign Het
Piwil2 A G 14: 70,376,017 V894A probably damaging Het
Polr1c A G 17: 46,245,064 S173P probably damaging Het
Prep C T 10: 45,155,525 A564V probably benign Het
Rab3gap1 T C 1: 127,938,185 probably benign Het
Rcc1 G C 4: 132,335,825 probably benign Het
Setdb1 G A 3: 95,338,860 P584S probably damaging Het
Slc12a7 A G 13: 73,788,652 I144V probably benign Het
Slc45a4 T C 15: 73,586,816 M295V probably benign Het
Slco1a1 T A 6: 141,921,839 D456V possibly damaging Het
Sspo G T 6: 48,498,734 C4928F probably damaging Het
St6galnac1 T A 11: 116,768,997 K163N probably benign Het
Tcp11l1 A T 2: 104,699,836 probably benign Het
Tns1 T A 1: 73,919,666 I1715F probably damaging Het
Trpa1 C T 1: 14,875,884 V1008M probably damaging Het
Ttc28 A G 5: 111,223,446 E587G probably damaging Het
Ubr4 T C 4: 139,450,553 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp8 G A 2: 126,742,114 probably benign Het
Zfc3h1 G T 10: 115,401,707 A464S possibly damaging Het
Zfp106 T C 2: 120,535,603 I108V probably benign Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7988:Scn11a UTSW 9 119765437 missense probably damaging 0.97
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
R8127:Scn11a UTSW 9 119804512 missense probably damaging 1.00
R8274:Scn11a UTSW 9 119803482 missense probably benign
R8344:Scn11a UTSW 9 119781970 missense probably benign 0.00
R8346:Scn11a UTSW 9 119778981 missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATCTCAAAGTCGTCTTCGCCC -3'
(R):5'- TTCAGGATTGTCCGCTTGGCTC -3'

Sequencing Primer
(F):5'- GCTGTGTTGAAGTTCTCTAGAATCAC -3'
(R):5'- TCAACATCGGTCTGCTTCTC -3'
Posted On2013-10-16