Incidental Mutation 'R0828:Adap2'
ID 78397
Institutional Source Beutler Lab
Gene Symbol Adap2
Ensembl Gene ENSMUSG00000020709
Gene Name ArfGAP with dual PH domains 2
Synonyms Centa2, centaurin alpha 2
MMRRC Submission 039008-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R0828 (G1)
Quality Score 124
Status Validated
Chromosome 11
Chromosomal Location 80044931-80069784 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 80056490 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021050] [ENSMUST00000134118]
AlphaFold Q8R2V5
Predicted Effect probably benign
Transcript: ENSMUST00000021050
SMART Domains Protein: ENSMUSP00000021050
Gene: ENSMUSG00000020709

DomainStartEndE-ValueType
ArfGap 9 130 1.62e-42 SMART
PH 133 235 4.57e-8 SMART
PH 256 363 2.35e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134118
SMART Domains Protein: ENSMUSP00000130731
Gene: ENSMUSG00000020709

DomainStartEndE-ValueType
ArfGap 9 130 1.62e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140556
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds beta-tubulin and increases the stability of microtubules. The encoded protein can also translocate to the cell membrane and bind phosphatidylinositol 3,4,5-trisphosphate (PtdInsP3) and inositol 1,3,4,5-tetrakisphosphate (InsP4). In addition, this protein is a GTPase-activating protein for ADP ribosylation factor 6 and may be able to block the entry of some RNA viruses. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik C T 11: 25,602,020 (GRCm39) C70Y unknown Het
Abi3bp C T 16: 56,498,193 (GRCm39) T929I probably damaging Het
Adgrg5 A G 8: 95,668,413 (GRCm39) probably null Het
Afdn C A 17: 14,124,260 (GRCm39) N1803K probably damaging Het
Alox12b T C 11: 69,057,132 (GRCm39) L451P possibly damaging Het
Ankrd26 T C 6: 118,510,434 (GRCm39) probably benign Het
Bcr A T 10: 74,993,039 (GRCm39) probably benign Het
Cacna1c T C 6: 118,734,347 (GRCm39) N300D probably benign Het
Camsap1 G T 2: 25,829,097 (GRCm39) Q876K probably damaging Het
Cdh10 A G 15: 18,986,837 (GRCm39) D356G possibly damaging Het
Cdipt T A 7: 126,576,092 (GRCm39) Y16N probably damaging Het
Cebpz T C 17: 79,233,411 (GRCm39) E772G probably benign Het
Cep350 A G 1: 155,828,992 (GRCm39) I304T probably benign Het
Chpt1 C A 10: 88,312,277 (GRCm39) G9V probably damaging Het
Col6a5 T A 9: 105,739,263 (GRCm39) probably null Het
Dock7 G T 4: 98,903,982 (GRCm39) P688T probably damaging Het
Ephb3 T A 16: 21,037,784 (GRCm39) probably benign Het
Fcgr2b T C 1: 170,788,599 (GRCm39) Y336C probably damaging Het
Flg2 A T 3: 93,110,639 (GRCm39) H889L unknown Het
Gucy2c C T 6: 136,686,746 (GRCm39) V806M probably damaging Het
Hmgxb3 T A 18: 61,304,426 (GRCm39) I55F probably damaging Het
Igsf9b T A 9: 27,230,901 (GRCm39) Y301* probably null Het
Il12rb2 C T 6: 67,333,691 (GRCm39) R196H probably benign Het
Itgam T C 7: 127,715,677 (GRCm39) probably null Het
Klhl25 T C 7: 75,515,943 (GRCm39) V283A probably damaging Het
Klhl5 T C 5: 65,320,135 (GRCm39) L423P probably damaging Het
Krt6a T C 15: 101,602,271 (GRCm39) N138S probably damaging Het
Lrba A T 3: 86,515,677 (GRCm39) probably null Het
Map4k5 T C 12: 69,852,100 (GRCm39) T828A probably damaging Het
Marchf8 T A 6: 116,382,639 (GRCm39) M434K probably benign Het
Mink1 C T 11: 70,500,971 (GRCm39) Q743* probably null Het
Mrgpra3 T C 7: 47,239,884 (GRCm39) N14S probably benign Het
Mroh7 T C 4: 106,557,073 (GRCm39) S808G probably damaging Het
Msi1 T C 5: 115,568,953 (GRCm39) probably null Het
Nrap A G 19: 56,333,990 (GRCm39) Y874H probably damaging Het
Nup205 T C 6: 35,171,501 (GRCm39) F455L probably benign Het
Or2t1 G T 14: 14,328,800 (GRCm38) V230L probably benign Het
Piwil2 A G 14: 70,613,466 (GRCm39) V894A probably damaging Het
Polr1c A G 17: 46,555,990 (GRCm39) S173P probably damaging Het
Pphln1-ps1 A G 16: 13,495,669 (GRCm39) Y256C probably damaging Het
Prep C T 10: 45,031,621 (GRCm39) A564V probably benign Het
Rab3gap1 T C 1: 127,865,922 (GRCm39) probably benign Het
Rcc1 G C 4: 132,063,136 (GRCm39) probably benign Het
Scn11a T A 9: 119,584,073 (GRCm39) D1514V probably benign Het
Setdb1 G A 3: 95,246,171 (GRCm39) P584S probably damaging Het
Slc12a7 A G 13: 73,936,771 (GRCm39) I144V probably benign Het
Slc45a4 T C 15: 73,458,665 (GRCm39) M295V probably benign Het
Slco1a1 T A 6: 141,867,565 (GRCm39) D456V possibly damaging Het
Sspo G T 6: 48,475,668 (GRCm39) C4928F probably damaging Het
St6galnac1 T A 11: 116,659,823 (GRCm39) K163N probably benign Het
Tcp11l1 A T 2: 104,530,181 (GRCm39) probably benign Het
Tns1 T A 1: 73,958,825 (GRCm39) I1715F probably damaging Het
Trpa1 C T 1: 14,946,108 (GRCm39) V1008M probably damaging Het
Ttc28 A G 5: 111,371,312 (GRCm39) E587G probably damaging Het
Ubr4 T C 4: 139,177,864 (GRCm39) probably benign Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Usp8 G A 2: 126,584,034 (GRCm39) probably benign Het
Zfc3h1 G T 10: 115,237,612 (GRCm39) A464S possibly damaging Het
Zfp106 T C 2: 120,366,084 (GRCm39) I108V probably benign Het
Other mutations in Adap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Adap2 APN 11 80,051,015 (GRCm39) missense probably damaging 1.00
IGL02442:Adap2 APN 11 80,068,032 (GRCm39) missense probably damaging 1.00
IGL02953:Adap2 APN 11 80,045,126 (GRCm39) missense probably damaging 0.99
PIT4283001:Adap2 UTSW 11 80,068,089 (GRCm39) missense probably damaging 1.00
R0157:Adap2 UTSW 11 80,056,527 (GRCm39) missense probably damaging 1.00
R0382:Adap2 UTSW 11 80,069,211 (GRCm39) splice site probably benign
R0499:Adap2 UTSW 11 80,066,905 (GRCm39) missense probably damaging 1.00
R0722:Adap2 UTSW 11 80,047,810 (GRCm39) missense possibly damaging 0.86
R1938:Adap2 UTSW 11 80,061,508 (GRCm39) missense probably damaging 1.00
R2268:Adap2 UTSW 11 80,056,552 (GRCm39) missense probably damaging 0.99
R3103:Adap2 UTSW 11 80,047,859 (GRCm39) missense probably damaging 1.00
R4621:Adap2 UTSW 11 80,064,899 (GRCm39) splice site probably null
R5157:Adap2 UTSW 11 80,047,772 (GRCm39) missense probably damaging 1.00
R6326:Adap2 UTSW 11 80,045,848 (GRCm39) missense probably damaging 1.00
R6914:Adap2 UTSW 11 80,045,891 (GRCm39) missense probably benign 0.01
R6942:Adap2 UTSW 11 80,045,891 (GRCm39) missense probably benign 0.01
R7835:Adap2 UTSW 11 80,051,057 (GRCm39) missense probably benign 0.11
R8879:Adap2 UTSW 11 80,047,785 (GRCm39) missense probably benign 0.02
R9183:Adap2 UTSW 11 80,045,882 (GRCm39) missense probably damaging 0.99
R9408:Adap2 UTSW 11 80,045,942 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGAGAAGAGTTCAGTATGACTCC -3'
(R):5'- ACTGCTCAGATACATTCGCAGTACTTG -3'

Sequencing Primer
(F):5'- CTCCAAGGAGCTGATGTCTG -3'
(R):5'- agcagcagcagcaggag -3'
Posted On 2013-10-16