Incidental Mutation 'R0829:Mitf'
ID78423
Institutional Source Beutler Lab
Gene Symbol Mitf
Ensembl Gene ENSMUSG00000035158
Gene Namemelanogenesis associated transcription factor
Synonymswh, mi, Gsfbcc2, bHLHe32, BCC2
MMRRC Submission 039009-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R0829 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location97807052-98021349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98003908 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 246 (I246F)
Ref Sequence ENSEMBL: ENSMUSP00000098683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043628] [ENSMUST00000043637] [ENSMUST00000101123] [ENSMUST00000113339] [ENSMUST00000139462] [ENSMUST00000203884] [ENSMUST00000203938]
Predicted Effect probably benign
Transcript: ENSMUST00000043628
AA Change: I155F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000044459
Gene: ENSMUSG00000035158
AA Change: I155F

DomainStartEndE-ValueType
HLH 210 263 5.53e-17 SMART
Pfam:DUF3371 290 416 9.5e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043637
AA Change: I262F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000044938
Gene: ENSMUSG00000035158
AA Change: I262F

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:MITF_TFEB_C_3_N 56 228 3.1e-52 PFAM
HLH 317 370 5.53e-17 SMART
Pfam:DUF3371 397 522 2.7e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101123
AA Change: I246F

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098683
Gene: ENSMUSG00000035158
AA Change: I246F

DomainStartEndE-ValueType
coiled coil region 44 74 N/A INTRINSIC
HLH 301 354 5.53e-17 SMART
Pfam:DUF3371 381 507 4.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113339
AA Change: I237F

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108965
Gene: ENSMUSG00000035158
AA Change: I237F

DomainStartEndE-ValueType
coiled coil region 35 65 N/A INTRINSIC
HLH 292 345 5.53e-17 SMART
Pfam:DUF3371 372 498 4.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139462
Predicted Effect probably benign
Transcript: ENSMUST00000203884
AA Change: I262F

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000145132
Gene: ENSMUSG00000035158
AA Change: I262F

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:MITF_TFEB_C_3_N 56 228 2.2e-49 PFAM
HLH 311 364 2.3e-19 SMART
Pfam:DUF3371 391 516 1.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203938
AA Change: I99F

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000144988
Gene: ENSMUSG00000035158
AA Change: I99F

DomainStartEndE-ValueType
Pfam:MITF_TFEB_C_3_N 7 60 2.2e-7 PFAM
HLH 148 201 2.3e-19 SMART
Pfam:DUF3371 228 353 9.2e-36 PFAM
Meta Mutation Damage Score 0.0890 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: This transcription factor serves at a critical point between extracellular signaling and downstream targets in cell specification in early eye and neural crest development. Mutant alleles have been identified that generate distinct phenotypes. Some of these alleles are being used to model the human diseases Waardenburg syndrome IIa and Tietz syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect development of melanocytes, mast cells, osteoclasts and pigmented epithelium. Mutants variably display lack of pigment in coat and eye, microphthalmia, hearing loss, bone resorption anomalies, mast cell deficiency and lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,198,105 T42I possibly damaging Het
Adprh C A 16: 38,445,788 A331S probably benign Het
Atp4b T G 8: 13,390,098 T83P probably damaging Het
Ccdc177 T C 12: 80,759,479 E7G probably damaging Het
Cercam G T 2: 29,871,067 R126L probably damaging Het
Cpb1 C T 3: 20,251,943 probably benign Het
Dnah7a T C 1: 53,504,079 M2311V probably benign Het
Dnah9 C A 11: 66,005,176 V2458L probably benign Het
Dnajb6 T C 5: 29,785,022 probably benign Het
Dst A G 1: 34,163,220 T210A probably damaging Het
Gfpt1 T C 6: 87,053,865 probably benign Het
Grin1 C T 2: 25,298,448 D429N probably benign Het
Iqck T C 7: 118,899,888 probably null Het
Itgb5 A G 16: 33,944,201 I359V probably benign Het
Lemd3 T C 10: 120,979,083 T82A probably benign Het
Lrrc74b A G 16: 17,558,390 probably benign Het
Msgn1 C T 12: 11,208,524 R142Q probably damaging Het
Myh8 C A 11: 67,283,500 probably benign Het
Nacad C A 11: 6,601,158 V678L probably benign Het
Nomo1 A G 7: 46,076,172 probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1186 A T 2: 88,526,228 Y215F probably damaging Het
Olfr1496 T A 19: 13,781,192 D191E probably damaging Het
Olfr213 A G 6: 116,541,265 T271A probably benign Het
Olfr724 C A 14: 49,961,046 V9L probably benign Het
Pcdh15 T A 10: 74,502,766 V1068E probably damaging Het
Plat A G 8: 22,772,257 Y99C probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm25 T C 12: 83,660,376 probably benign Het
Scaf11 T C 15: 96,418,689 D998G probably damaging Het
Serpinb6a A G 13: 33,935,701 probably benign Het
Spef2 T C 15: 9,687,813 I507M probably benign Het
Srebf2 T A 15: 82,177,589 probably null Het
Tert T C 13: 73,644,385 C924R probably damaging Het
Tmem110 C T 14: 30,862,885 R56C probably damaging Het
Usp19 T C 9: 108,493,801 S221P probably benign Het
Xkr4 C T 1: 3,671,246 A35T possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Other mutations in Mitf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Mitf APN 6 98017931 missense possibly damaging 0.69
IGL01516:Mitf APN 6 98010390 splice site probably null
IGL01617:Mitf APN 6 97996428 missense probably benign 0.00
IGL01875:Mitf APN 6 98017895 missense probably benign 0.22
R0010:Mitf UTSW 6 97807281 missense probably benign 0.25
R0010:Mitf UTSW 6 97807281 missense probably benign 0.25
R0079:Mitf UTSW 6 97996440 missense probably benign 0.00
R0381:Mitf UTSW 6 97993143 missense probably damaging 1.00
R0494:Mitf UTSW 6 97994429 missense probably benign 0.00
R0633:Mitf UTSW 6 98003904 missense probably damaging 0.98
R1189:Mitf UTSW 6 98006125 missense possibly damaging 0.67
R1459:Mitf UTSW 6 98010467 missense probably damaging 1.00
R1766:Mitf UTSW 6 97941099 missense probably damaging 1.00
R1864:Mitf UTSW 6 98010422 missense probably damaging 1.00
R1891:Mitf UTSW 6 97941276 missense probably benign 0.00
R3934:Mitf UTSW 6 97993253 missense probably damaging 1.00
R3936:Mitf UTSW 6 97993253 missense probably damaging 1.00
R4323:Mitf UTSW 6 97991949 missense probably benign 0.12
R5052:Mitf UTSW 6 98010445 missense possibly damaging 0.91
R5097:Mitf UTSW 6 97996462 missense possibly damaging 0.63
R5297:Mitf UTSW 6 97994430 missense probably benign 0.09
R5646:Mitf UTSW 6 98013694 missense probably damaging 1.00
R6109:Mitf UTSW 6 97996468 missense probably damaging 1.00
R6351:Mitf UTSW 6 98003912 missense possibly damaging 0.85
R6411:Mitf UTSW 6 98010472 critical splice donor site probably null
R7855:Mitf UTSW 6 97993196 missense probably damaging 1.00
R7904:Mitf UTSW 6 98013710 missense probably damaging 0.99
R7975:Mitf UTSW 6 98018029 missense probably benign 0.17
R8061:Mitf UTSW 6 97993298 missense probably damaging 0.98
Z1177:Mitf UTSW 6 98006121 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGGAATGTGCCCACCAGACAGAAG -3'
(R):5'- TGCTGTTCCGTTGGTAACGCTC -3'

Sequencing Primer
(F):5'- AATTCTGTGTGAGTCCTCAGAC -3'
(R):5'- GTAACGCTCCCCAGTGG -3'
Posted On2013-10-16