Incidental Mutation 'R0829:Iqck'
ID 78426
Institutional Source Beutler Lab
Gene Symbol Iqck
Ensembl Gene ENSMUSG00000073856
Gene Name IQ motif containing K
Synonyms
MMRRC Submission 039009-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R0829 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 118855752-118972652 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 118899888 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098087] [ENSMUST00000098087] [ENSMUST00000106547] [ENSMUST00000106547] [ENSMUST00000152136]
AlphaFold D3YYL3
Predicted Effect probably null
Transcript: ENSMUST00000098087
SMART Domains Protein: ENSMUSP00000095693
Gene: ENSMUSG00000073856

DomainStartEndE-ValueType
low complexity region 111 120 N/A INTRINSIC
IQ 219 241 7.58e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000098087
SMART Domains Protein: ENSMUSP00000095693
Gene: ENSMUSG00000073856

DomainStartEndE-ValueType
low complexity region 111 120 N/A INTRINSIC
IQ 219 241 7.58e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106547
SMART Domains Protein: ENSMUSP00000102157
Gene: ENSMUSG00000073856

DomainStartEndE-ValueType
low complexity region 108 117 N/A INTRINSIC
IQ 216 238 7.58e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106547
SMART Domains Protein: ENSMUSP00000102157
Gene: ENSMUSG00000073856

DomainStartEndE-ValueType
low complexity region 108 117 N/A INTRINSIC
IQ 216 238 7.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153518
Meta Mutation Damage Score 0.9482 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the IQ motif-containing family of proteins. The IQ motif serves as a binding site for different EF-hand proteins such as calmodulin. This gene was identified as a potential candidate gene for obsessive-compulsive disorder in a genome-wide association study. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,198,105 T42I possibly damaging Het
Adprh C A 16: 38,445,788 A331S probably benign Het
Atp4b T G 8: 13,390,098 T83P probably damaging Het
Ccdc177 T C 12: 80,759,479 E7G probably damaging Het
Cercam G T 2: 29,871,067 R126L probably damaging Het
Cpb1 C T 3: 20,251,943 probably benign Het
Dnah7a T C 1: 53,504,079 M2311V probably benign Het
Dnah9 C A 11: 66,005,176 V2458L probably benign Het
Dnajb6 T C 5: 29,785,022 probably benign Het
Dst A G 1: 34,163,220 T210A probably damaging Het
Gfpt1 T C 6: 87,053,865 probably benign Het
Grin1 C T 2: 25,298,448 D429N probably benign Het
Itgb5 A G 16: 33,944,201 I359V probably benign Het
Lemd3 T C 10: 120,979,083 T82A probably benign Het
Lrrc74b A G 16: 17,558,390 probably benign Het
Mitf A T 6: 98,003,908 I246F possibly damaging Het
Msgn1 C T 12: 11,208,524 R142Q probably damaging Het
Myh8 C A 11: 67,283,500 probably benign Het
Nacad C A 11: 6,601,158 V678L probably benign Het
Nomo1 A G 7: 46,076,172 probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1186 A T 2: 88,526,228 Y215F probably damaging Het
Olfr1496 T A 19: 13,781,192 D191E probably damaging Het
Olfr213 A G 6: 116,541,265 T271A probably benign Het
Olfr724 C A 14: 49,961,046 V9L probably benign Het
Pcdh15 T A 10: 74,502,766 V1068E probably damaging Het
Plat A G 8: 22,772,257 Y99C probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm25 T C 12: 83,660,376 probably benign Het
Scaf11 T C 15: 96,418,689 D998G probably damaging Het
Serpinb6a A G 13: 33,935,701 probably benign Het
Spef2 T C 15: 9,687,813 I507M probably benign Het
Srebf2 T A 15: 82,177,589 probably null Het
Tert T C 13: 73,644,385 C924R probably damaging Het
Tmem110 C T 14: 30,862,885 R56C probably damaging Het
Usp19 T C 9: 108,493,801 S221P probably benign Het
Xkr4 C T 1: 3,671,246 A35T possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Other mutations in Iqck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Iqck APN 7 118877678 missense probably damaging 1.00
IGL02810:Iqck APN 7 118971439 missense possibly damaging 0.94
IGL03403:Iqck APN 7 118876271 missense probably benign 0.21
R0541:Iqck UTSW 7 118915594 missense probably damaging 1.00
R0781:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R0898:Iqck UTSW 7 118971441 missense probably damaging 0.99
R2273:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R2274:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R2275:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R2509:Iqck UTSW 7 118876282 missense probably benign
R4033:Iqck UTSW 7 118941604 missense probably damaging 1.00
R6299:Iqck UTSW 7 118876262 missense unknown
R6520:Iqck UTSW 7 118941631 missense probably damaging 1.00
R7095:Iqck UTSW 7 118915591 missense probably damaging 1.00
R7823:Iqck UTSW 7 118872823 missense probably damaging 1.00
R9038:Iqck UTSW 7 118899658 missense probably damaging 1.00
R9218:Iqck UTSW 7 118941679 missense probably damaging 0.98
Z1176:Iqck UTSW 7 118941654 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGCCTGCGATTTCCTGACTGAGTG -3'
(R):5'- AAGCAAGCCAGTGTGAACCCAG -3'

Sequencing Primer
(F):5'- GCTGTACAAGTAAGCTGTTCC -3'
(R):5'- ccccagaagccacacag -3'
Posted On 2013-10-16