Incidental Mutation 'R0829:Atp4b'
ID78427
Institutional Source Beutler Lab
Gene Symbol Atp4b
Ensembl Gene ENSMUSG00000031449
Gene NameATPase, H+/K+ exchanging, beta polypeptide
SynonymsH+,K+-ATPase, H,K-ATPase-Beta, H+/K+-ATPase beta
MMRRC Submission 039009-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0829 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13386205-13396825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 13390098 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 83 (T83P)
Ref Sequence ENSEMBL: ENSMUSP00000033826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033826]
Predicted Effect probably damaging
Transcript: ENSMUST00000033826
AA Change: T83P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033826
Gene: ENSMUSG00000031449
AA Change: T83P

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 7 288 5.7e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211331
Meta Mutation Damage Score 0.4395 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes the beta subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are superficially normal but have hypertrophied stomach mucosa, neutral luminal pH in the stomach, and hypergastrinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,198,105 T42I possibly damaging Het
Adprh C A 16: 38,445,788 A331S probably benign Het
Ccdc177 T C 12: 80,759,479 E7G probably damaging Het
Cercam G T 2: 29,871,067 R126L probably damaging Het
Cpb1 C T 3: 20,251,943 probably benign Het
Dnah7a T C 1: 53,504,079 M2311V probably benign Het
Dnah9 C A 11: 66,005,176 V2458L probably benign Het
Dnajb6 T C 5: 29,785,022 probably benign Het
Dst A G 1: 34,163,220 T210A probably damaging Het
Gfpt1 T C 6: 87,053,865 probably benign Het
Grin1 C T 2: 25,298,448 D429N probably benign Het
Iqck T C 7: 118,899,888 probably null Het
Itgb5 A G 16: 33,944,201 I359V probably benign Het
Lemd3 T C 10: 120,979,083 T82A probably benign Het
Lrrc74b A G 16: 17,558,390 probably benign Het
Mitf A T 6: 98,003,908 I246F possibly damaging Het
Msgn1 C T 12: 11,208,524 R142Q probably damaging Het
Myh8 C A 11: 67,283,500 probably benign Het
Nacad C A 11: 6,601,158 V678L probably benign Het
Nomo1 A G 7: 46,076,172 probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1186 A T 2: 88,526,228 Y215F probably damaging Het
Olfr1496 T A 19: 13,781,192 D191E probably damaging Het
Olfr213 A G 6: 116,541,265 T271A probably benign Het
Olfr724 C A 14: 49,961,046 V9L probably benign Het
Pcdh15 T A 10: 74,502,766 V1068E probably damaging Het
Plat A G 8: 22,772,257 Y99C probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm25 T C 12: 83,660,376 probably benign Het
Scaf11 T C 15: 96,418,689 D998G probably damaging Het
Serpinb6a A G 13: 33,935,701 probably benign Het
Spef2 T C 15: 9,687,813 I507M probably benign Het
Srebf2 T A 15: 82,177,589 probably null Het
Tert T C 13: 73,644,385 C924R probably damaging Het
Tmem110 C T 14: 30,862,885 R56C probably damaging Het
Usp19 T C 9: 108,493,801 S221P probably benign Het
Xkr4 C T 1: 3,671,246 A35T possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Other mutations in Atp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Atp4b APN 8 13389679 missense probably damaging 1.00
IGL02596:Atp4b APN 8 13393471 missense possibly damaging 0.87
R0558:Atp4b UTSW 8 13393523 missense possibly damaging 0.62
R0963:Atp4b UTSW 8 13390014 missense probably benign 0.00
R1528:Atp4b UTSW 8 13389693 missense possibly damaging 0.78
R1605:Atp4b UTSW 8 13393489 missense probably damaging 1.00
R2022:Atp4b UTSW 8 13387477 missense possibly damaging 0.88
R3824:Atp4b UTSW 8 13393549 missense probably damaging 1.00
R3825:Atp4b UTSW 8 13393549 missense probably damaging 1.00
R4108:Atp4b UTSW 8 13396640 critical splice donor site probably null
R4400:Atp4b UTSW 8 13388810 missense probably damaging 1.00
R4606:Atp4b UTSW 8 13389998 missense probably damaging 1.00
R4681:Atp4b UTSW 8 13389700 missense probably benign 0.01
R6056:Atp4b UTSW 8 13388782 missense probably damaging 1.00
R7485:Atp4b UTSW 8 13386732 missense probably benign
R7888:Atp4b UTSW 8 13389811 missense probably damaging 0.98
R8743:Atp4b UTSW 8 13393489 missense probably damaging 1.00
R8896:Atp4b UTSW 8 13387514 missense probably benign 0.00
Z1177:Atp4b UTSW 8 13389794 missense probably benign 0.00
Z1177:Atp4b UTSW 8 13396684 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCCATTCTCGTAGGAAGCAGACAC -3'
(R):5'- GAGGTCAGCATCTACTGCACCAATC -3'

Sequencing Primer
(F):5'- GCAGACACGCTGCTACATTTG -3'
(R):5'- ACCAAGTGTCACTATTGCTGG -3'
Posted On2013-10-16