Incidental Mutation 'R0829:Tert'
ID78439
Institutional Source Beutler Lab
Gene Symbol Tert
Ensembl Gene ENSMUSG00000021611
Gene Nametelomerase reverse transcriptase
SynonymsTR
MMRRC Submission 039009-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R0829 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location73626911-73649843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73644385 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 924 (C924R)
Ref Sequence ENSEMBL: ENSMUSP00000022104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022104] [ENSMUST00000221522] [ENSMUST00000223303]
Predicted Effect probably damaging
Transcript: ENSMUST00000022104
AA Change: C924R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022104
Gene: ENSMUSG00000021611
AA Change: C924R

DomainStartEndE-ValueType
Blast:Telomerase_RBD 329 375 2e-6 BLAST
Telomerase_RBD 449 584 5.02e-75 SMART
Blast:Telomerase_RBD 651 688 1e-5 BLAST
Pfam:RVT_1 787 918 6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221522
Predicted Effect probably benign
Transcript: ENSMUST00000222251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222912
Predicted Effect probably benign
Transcript: ENSMUST00000223303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223325
Meta Mutation Damage Score 0.9682 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of impaired telomerase function, homozygous mutant mice are overtly normal in early generations. Impaired fertility has been reported in later generations for homozygotes of at least one knockout allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,198,105 T42I possibly damaging Het
Adprh C A 16: 38,445,788 A331S probably benign Het
Atp4b T G 8: 13,390,098 T83P probably damaging Het
Ccdc177 T C 12: 80,759,479 E7G probably damaging Het
Cercam G T 2: 29,871,067 R126L probably damaging Het
Cpb1 C T 3: 20,251,943 probably benign Het
Dnah7a T C 1: 53,504,079 M2311V probably benign Het
Dnah9 C A 11: 66,005,176 V2458L probably benign Het
Dnajb6 T C 5: 29,785,022 probably benign Het
Dst A G 1: 34,163,220 T210A probably damaging Het
Gfpt1 T C 6: 87,053,865 probably benign Het
Grin1 C T 2: 25,298,448 D429N probably benign Het
Iqck T C 7: 118,899,888 probably null Het
Itgb5 A G 16: 33,944,201 I359V probably benign Het
Lemd3 T C 10: 120,979,083 T82A probably benign Het
Lrrc74b A G 16: 17,558,390 probably benign Het
Mitf A T 6: 98,003,908 I246F possibly damaging Het
Msgn1 C T 12: 11,208,524 R142Q probably damaging Het
Myh8 C A 11: 67,283,500 probably benign Het
Nacad C A 11: 6,601,158 V678L probably benign Het
Nomo1 A G 7: 46,076,172 probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1186 A T 2: 88,526,228 Y215F probably damaging Het
Olfr1496 T A 19: 13,781,192 D191E probably damaging Het
Olfr213 A G 6: 116,541,265 T271A probably benign Het
Olfr724 C A 14: 49,961,046 V9L probably benign Het
Pcdh15 T A 10: 74,502,766 V1068E probably damaging Het
Plat A G 8: 22,772,257 Y99C probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm25 T C 12: 83,660,376 probably benign Het
Scaf11 T C 15: 96,418,689 D998G probably damaging Het
Serpinb6a A G 13: 33,935,701 probably benign Het
Spef2 T C 15: 9,687,813 I507M probably benign Het
Srebf2 T A 15: 82,177,589 probably null Het
Tmem110 C T 14: 30,862,885 R56C probably damaging Het
Usp19 T C 9: 108,493,801 S221P probably benign Het
Xkr4 C T 1: 3,671,246 A35T possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Other mutations in Tert
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Tert APN 13 73628297 missense possibly damaging 0.76
IGL01585:Tert APN 13 73634344 missense probably benign 0.15
IGL03167:Tert APN 13 73640000 missense probably damaging 1.00
FR4304:Tert UTSW 13 73648302 utr 3 prime probably benign
FR4342:Tert UTSW 13 73648300 utr 3 prime probably benign
FR4589:Tert UTSW 13 73648304 utr 3 prime probably benign
PIT4377001:Tert UTSW 13 73628261 missense possibly damaging 0.54
R0372:Tert UTSW 13 73648991 missense probably damaging 1.00
R0433:Tert UTSW 13 73627081 missense probably damaging 1.00
R1023:Tert UTSW 13 73642059 missense probably benign 0.41
R1236:Tert UTSW 13 73636379 missense probably damaging 0.99
R1331:Tert UTSW 13 73648354 missense probably damaging 1.00
R1426:Tert UTSW 13 73642353 splice site probably benign
R1467:Tert UTSW 13 73628209 missense probably benign 0.10
R1467:Tert UTSW 13 73628209 missense probably benign 0.10
R1521:Tert UTSW 13 73642056 missense probably damaging 1.00
R2484:Tert UTSW 13 73647985 missense probably benign
R3162:Tert UTSW 13 73627409 missense possibly damaging 0.45
R3162:Tert UTSW 13 73627409 missense possibly damaging 0.45
R4428:Tert UTSW 13 73627475 missense probably damaging 1.00
R4430:Tert UTSW 13 73627475 missense probably damaging 1.00
R4431:Tert UTSW 13 73627475 missense probably damaging 1.00
R4630:Tert UTSW 13 73648991 missense probably damaging 1.00
R4696:Tert UTSW 13 73627820 missense probably benign 0.25
R4751:Tert UTSW 13 73628063 missense possibly damaging 0.89
R4926:Tert UTSW 13 73648389 missense possibly damaging 0.62
R5011:Tert UTSW 13 73646309 critical splice donor site probably null
R5013:Tert UTSW 13 73646309 critical splice donor site probably null
R5061:Tert UTSW 13 73634278 missense probably damaging 1.00
R5268:Tert UTSW 13 73627354 missense probably damaging 1.00
R5323:Tert UTSW 13 73648371 missense probably benign 0.07
R5396:Tert UTSW 13 73639243 missense probably damaging 0.97
R5445:Tert UTSW 13 73644284 missense probably benign 0.00
R5680:Tert UTSW 13 73642351 splice site probably null
R5688:Tert UTSW 13 73639156 missense probably damaging 1.00
R6092:Tert UTSW 13 73628581 missense probably benign 0.34
R6973:Tert UTSW 13 73627988 missense probably benign 0.02
R7069:Tert UTSW 13 73628410 missense probably damaging 0.99
R7317:Tert UTSW 13 73642376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCCCAGAACACCTCTGAGAAC -3'
(R):5'- GCCCATCTCCATGAAGAAAGGGAAC -3'

Sequencing Primer
(F):5'- GAACACCTCTGAGAACTTGTGTG -3'
(R):5'- AGGGAACACCTTTTGACCTATC -3'
Posted On2013-10-16