Incidental Mutation 'R0829:Lrrc74b'
ID78445
Institutional Source Beutler Lab
Gene Symbol Lrrc74b
Ensembl Gene ENSMUSG00000022759
Gene Nameleucine rich repeat containing 74B
Synonyms4930451C15Rik
MMRRC Submission 039009-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R0829 (G1)
Quality Score138
Status Validated
Chromosome16
Chromosomal Location17544465-17561247 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 17558390 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023441] [ENSMUST00000023442] [ENSMUST00000065125] [ENSMUST00000100123] [ENSMUST00000171002] [ENSMUST00000231806] [ENSMUST00000232637]
Predicted Effect probably benign
Transcript: ENSMUST00000023441
SMART Domains Protein: ENSMUSP00000023441
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 385 7.9e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023442
SMART Domains Protein: ENSMUSP00000023442
Gene: ENSMUSG00000022759

DomainStartEndE-ValueType
LRR 71 103 3.9e0 SMART
LRR 104 131 1.04e-3 SMART
LRR 132 159 1.14e1 SMART
LRR 160 187 7.78e-3 SMART
LRR 188 215 3.9e0 SMART
LRR 216 243 7.89e-1 SMART
LRR 244 271 6.78e-3 SMART
LRR 272 299 5.51e-1 SMART
low complexity region 342 355 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000070127
Gene: ENSMUSG00000022759

DomainStartEndE-ValueType
LRR 71 103 3.9e0 SMART
LRR 104 131 1.04e-3 SMART
LRR 132 159 1.14e1 SMART
LRR 160 187 7.78e-3 SMART
LRR 188 215 3.9e0 SMART
LRR 216 243 7.89e-1 SMART
LRR 244 271 6.78e-3 SMART
LRR 272 299 5.51e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100123
SMART Domains Protein: ENSMUSP00000097699
Gene: ENSMUSG00000022759

DomainStartEndE-ValueType
LRR 71 103 3.9e0 SMART
LRR 104 131 1.04e-3 SMART
LRR 132 159 1.14e1 SMART
LRR 160 187 7.78e-3 SMART
LRR 188 215 3.9e0 SMART
LRR 216 243 7.89e-1 SMART
LRR 244 271 6.78e-3 SMART
LRR 272 299 5.51e-1 SMART
LRR 300 327 4.16e0 SMART
low complexity region 374 387 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138839
Predicted Effect probably benign
Transcript: ENSMUST00000171002
SMART Domains Protein: ENSMUSP00000132727
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 197 1e-65 PFAM
Pfam:P2X_receptor 185 362 7e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232230
Predicted Effect probably benign
Transcript: ENSMUST00000232637
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 95% (37/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,198,105 T42I possibly damaging Het
Adprh C A 16: 38,445,788 A331S probably benign Het
Atp4b T G 8: 13,390,098 T83P probably damaging Het
Ccdc177 T C 12: 80,759,479 E7G probably damaging Het
Cercam G T 2: 29,871,067 R126L probably damaging Het
Cpb1 C T 3: 20,251,943 probably benign Het
Dnah7a T C 1: 53,504,079 M2311V probably benign Het
Dnah9 C A 11: 66,005,176 V2458L probably benign Het
Dnajb6 T C 5: 29,785,022 probably benign Het
Dst A G 1: 34,163,220 T210A probably damaging Het
Gfpt1 T C 6: 87,053,865 probably benign Het
Grin1 C T 2: 25,298,448 D429N probably benign Het
Iqck T C 7: 118,899,888 probably null Het
Itgb5 A G 16: 33,944,201 I359V probably benign Het
Lemd3 T C 10: 120,979,083 T82A probably benign Het
Mitf A T 6: 98,003,908 I246F possibly damaging Het
Msgn1 C T 12: 11,208,524 R142Q probably damaging Het
Myh8 C A 11: 67,283,500 probably benign Het
Nacad C A 11: 6,601,158 V678L probably benign Het
Nomo1 A G 7: 46,076,172 probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1186 A T 2: 88,526,228 Y215F probably damaging Het
Olfr1496 T A 19: 13,781,192 D191E probably damaging Het
Olfr213 A G 6: 116,541,265 T271A probably benign Het
Olfr724 C A 14: 49,961,046 V9L probably benign Het
Pcdh15 T A 10: 74,502,766 V1068E probably damaging Het
Plat A G 8: 22,772,257 Y99C probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm25 T C 12: 83,660,376 probably benign Het
Scaf11 T C 15: 96,418,689 D998G probably damaging Het
Serpinb6a A G 13: 33,935,701 probably benign Het
Spef2 T C 15: 9,687,813 I507M probably benign Het
Srebf2 T A 15: 82,177,589 probably null Het
Tert T C 13: 73,644,385 C924R probably damaging Het
Tmem110 C T 14: 30,862,885 R56C probably damaging Het
Usp19 T C 9: 108,493,801 S221P probably benign Het
Xkr4 C T 1: 3,671,246 A35T possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Other mutations in Lrrc74b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Lrrc74b APN 16 17545558 missense probably benign 0.00
IGL02402:Lrrc74b APN 16 17558164 splice site probably benign
P0043:Lrrc74b UTSW 16 17558159 splice site probably benign
R0131:Lrrc74b UTSW 16 17553152 missense probably damaging 1.00
R0131:Lrrc74b UTSW 16 17553152 missense probably damaging 1.00
R0132:Lrrc74b UTSW 16 17553152 missense probably damaging 1.00
R1463:Lrrc74b UTSW 16 17559873 missense probably benign 0.00
R1681:Lrrc74b UTSW 16 17559753 missense probably damaging 1.00
R1938:Lrrc74b UTSW 16 17553194 missense probably benign 0.41
R4790:Lrrc74b UTSW 16 17549853 missense probably damaging 1.00
R5428:Lrrc74b UTSW 16 17558261 missense probably damaging 0.99
R6198:Lrrc74b UTSW 16 17548786 missense probably damaging 0.96
R7910:Lrrc74b UTSW 16 17558349 nonsense probably null
R7991:Lrrc74b UTSW 16 17558349 nonsense probably null
X0063:Lrrc74b UTSW 16 17553208 missense probably benign 0.05
Z1177:Lrrc74b UTSW 16 17558168 critical splice donor site probably null
Z1177:Lrrc74b UTSW 16 17558172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGACTGCCCAGACTTTGTTACC -3'
(R):5'- TGCTACCACAGCATTCTTCACAGAC -3'

Sequencing Primer
(F):5'- TTACCTGCCAGGTCATTGAG -3'
(R):5'- TCTTCACAGACAGTCATGGAGTG -3'
Posted On2013-10-16