Mutagenetix > Incidental Mutation

Incidental Mutation 'R0829:Itgb5'

78446

Institutional Source

Beutler Lab

Gene Symbol

Itgb5

Ensembl Gene

ENSMUSG00000022817

Gene Name

integrin beta 5

Synonyms

ESTM23, [b]-5, beta-5, beta5, [b]5, [b]5A, [b]5B

MMRRC Submission

039009-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0829 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33829665-33949338 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33944201 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 359 (I359V)

Ref Sequence

ENSEMBL: ENSMUSP00000156332 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069345] [ENSMUST00000115028] [ENSMUST00000232262]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000069345
AA Change: I672V

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000069416
Gene: ENSMUSG00000022817
AA Change: I672V

Domain	Start	End	E-Value	Type
PSI	27	76	1.4e-7	SMART
INB	35	463	1.18e-284	SMART
VWA	137	372	5.95e-7	SMART
internal_repeat_1	492	549	3.16e-7	PROSPERO
EGF	554	586	1.95e1	SMART
Integrin_B_tail	635	719	1.56e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115028
AA Change: I672V

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000110680
Gene: ENSMUSG00000022817
AA Change: I672V

Domain	Start	End	E-Value	Type
PSI	27	76	1.4e-7	SMART
INB	35	463	1.18e-284	SMART
VWA	137	372	5.95e-7	SMART
internal_repeat_1	492	549	3.16e-7	PROSPERO
EGF	554	586	1.95e1	SMART
Integrin_B_tail	635	719	1.56e-21	SMART
Integrin_b_cyt	743	790	5.97e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151930

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231409

Predicted Effect

probably benign
Transcript: ENSMUST00000232262
AA Change: I359V

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)

Meta Mutation Damage Score

0.1080

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.7%

Validation Efficiency

95% (37/39)

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation do not appear to differ from normal in respect to development, reproduction, adenovirus infection, or wound healing. Mutant keratinocytes do show reduced migration on, and adhesion to, vitronectin in vitro. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	G	A	2: 111,198,105	T42I	possibly damaging	Het
Adprh	C	A	16: 38,445,788	A331S	probably benign	Het
Atp4b	T	G	8: 13,390,098	T83P	probably damaging	Het
Ccdc177	T	C	12: 80,759,479	E7G	probably damaging	Het
Cercam	G	T	2: 29,871,067	R126L	probably damaging	Het
Cpb1	C	T	3: 20,251,943		probably benign	Het
Dnah7a	T	C	1: 53,504,079	M2311V	probably benign	Het
Dnah9	C	A	11: 66,005,176	V2458L	probably benign	Het
Dnajb6	T	C	5: 29,785,022		probably benign	Het
Dst	A	G	1: 34,163,220	T210A	probably damaging	Het
Gfpt1	T	C	6: 87,053,865		probably benign	Het
Grin1	C	T	2: 25,298,448	D429N	probably benign	Het
Iqck	T	C	7: 118,899,888		probably null	Het
Lemd3	T	C	10: 120,979,083	T82A	probably benign	Het
Lrrc74b	A	G	16: 17,558,390		probably benign	Het
Mitf	A	T	6: 98,003,908	I246F	possibly damaging	Het
Msgn1	C	T	12: 11,208,524	R142Q	probably damaging	Het
Myh8	C	A	11: 67,283,500		probably benign	Het
Nacad	C	A	11: 6,601,158	V678L	probably benign	Het
Nomo1	A	G	7: 46,076,172		probably benign	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1186	A	T	2: 88,526,228	Y215F	probably damaging	Het
Olfr1496	T	A	19: 13,781,192	D191E	probably damaging	Het
Olfr213	A	G	6: 116,541,265	T271A	probably benign	Het
Olfr724	C	A	14: 49,961,046	V9L	probably benign	Het
Pcdh15	T	A	10: 74,502,766	V1068E	probably damaging	Het
Plat	A	G	8: 22,772,257	Y99C	probably damaging	Het
Rasl10b	G	A	11: 83,417,839		probably null	Het
Rbm25	T	C	12: 83,660,376		probably benign	Het
Scaf11	T	C	15: 96,418,689	D998G	probably damaging	Het
Serpinb6a	A	G	13: 33,935,701		probably benign	Het
Spef2	T	C	15: 9,687,813	I507M	probably benign	Het
Srebf2	T	A	15: 82,177,589		probably null	Het
Tert	T	C	13: 73,644,385	C924R	probably damaging	Het
Tmem110	C	T	14: 30,862,885	R56C	probably damaging	Het
Usp19	T	C	9: 108,493,801	S221P	probably benign	Het
Xkr4	C	T	1: 3,671,246	A35T	possibly damaging	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het

Other mutations in Itgb5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Itgb5	APN	16	33884975	missense	probably damaging	1.00
IGL01121:Itgb5	APN	16	33919989	missense	probably benign	0.00
IGL01620:Itgb5	APN	16	33919798	missense	probably damaging	1.00
IGL02332:Itgb5	APN	16	33920130	nonsense	probably null
IGL02869:Itgb5	APN	16	33844992	missense	possibly damaging	0.94
IGL02881:Itgb5	APN	16	33919905	missense	probably benign	0.00
IGL02941:Itgb5	APN	16	33944095	splice site	probably benign
IGL03216:Itgb5	APN	16	33902838	missense	probably benign	0.38
IGL03351:Itgb5	APN	16	33910552	missense	probably benign	0.00
PIT4812001:Itgb5	UTSW	16	33919987	missense	probably damaging	1.00
R0744:Itgb5	UTSW	16	33900583	missense	probably damaging	0.99
R0836:Itgb5	UTSW	16	33900583	missense	probably damaging	0.99
R1387:Itgb5	UTSW	16	33900515	nonsense	probably null
R1703:Itgb5	UTSW	16	33910500	missense	probably benign	0.01
R1783:Itgb5	UTSW	16	33940562	missense	probably benign	0.13
R1826:Itgb5	UTSW	16	33865560	missense	possibly damaging	0.48
R1889:Itgb5	UTSW	16	33910469	missense	probably damaging	1.00
R2374:Itgb5	UTSW	16	33919798	missense	probably damaging	1.00
R4307:Itgb5	UTSW	16	33948732	missense	possibly damaging	0.80
R4355:Itgb5	UTSW	16	33844997	missense	probably damaging	0.98
R4796:Itgb5	UTSW	16	33885021	missense	possibly damaging	0.83
R4879:Itgb5	UTSW	16	33875978	missense	probably damaging	1.00
R6165:Itgb5	UTSW	16	33899242	missense	probably benign	0.01
R6584:Itgb5	UTSW	16	33885030	missense	probably damaging	1.00
R6617:Itgb5	UTSW	16	33946592	missense	probably benign	0.01
R6748:Itgb5	UTSW	16	33899297	missense	probably damaging	1.00
R6979:Itgb5	UTSW	16	33919986	missense	probably damaging	1.00
R7090:Itgb5	UTSW	16	33885094	missense	probably damaging	1.00
R7150:Itgb5	UTSW	16	33940643	missense	probably benign	0.03
R7403:Itgb5	UTSW	16	33902793	critical splice acceptor site	probably null
R7418:Itgb5	UTSW	16	33885094	missense	probably damaging	1.00
R7719:Itgb5	UTSW	16	33920116	missense	probably benign	0.01
R8309:Itgb5	UTSW	16	33865553	missense	probably benign	0.00
R8347:Itgb5	UTSW	16	33940678	missense	probably damaging	1.00
R8856:Itgb5	UTSW	16	33900592	missense	probably damaging	1.00
R9100:Itgb5	UTSW	16	33920181	missense	possibly damaging	0.91
R9194:Itgb5	UTSW	16	33900511	missense	probably damaging	1.00
R9309:Itgb5	UTSW	16	33920046	missense	probably benign	0.00
R9343:Itgb5	UTSW	16	33910456	splice site	probably benign
R9629:Itgb5	UTSW	16	33875925	missense	probably damaging	1.00
R9683:Itgb5	UTSW	16	33919965	missense	probably damaging	0.97
R9710:Itgb5	UTSW	16	33865547	missense	probably benign	0.00
X0022:Itgb5	UTSW	16	33845050	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- GGAAACCTCTTCCACAGAGCTGAC -3'
(R):5'- GTCCTGCCAATAACATGCAAGCG -3'

Sequencing Primer
(F):5'- GTGGCAAATTGACCAGTATACC -3'
(R):5'- TAACATGCAAGCGCCTCAC -3'

Posted On

2013-10-16