Incidental Mutation 'R0812:Kcna10'
ID78458
Institutional Source Beutler Lab
Gene Symbol Kcna10
Ensembl Gene ENSMUSG00000042861
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 10
SynonymsKcna8, Kv1.8
MMRRC Submission 038992-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R0812 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107183056-107195721 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107195259 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 402 (E402V)
Ref Sequence ENSEMBL: ENSMUSP00000088118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055064]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055064
AA Change: E402V

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088118
Gene: ENSMUSG00000042861
AA Change: E402V

DomainStartEndE-ValueType
BTB 86 186 1.07e-6 SMART
Pfam:Ion_trans 215 468 3.4e-51 PFAM
Pfam:Ion_trans_2 376 461 6.2e-16 PFAM
Meta Mutation Damage Score 0.0927 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.8%
  • 20x: 91.7%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It is specifically regulated by cGMP and postulated to mediate the effects of substances that increase intracellular cGMP. This gene is intronless, and the gene is clustered with genes KCNA2 and KCNA3 on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significant vestibular and mild hearing dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,713,414 F858S probably damaging Het
Abcb1a T C 5: 8,713,229 S586P probably damaging Het
Abcc3 G A 11: 94,375,202 probably benign Het
Ap5z1 G A 5: 142,475,791 R583H probably benign Het
Arrb1 G T 7: 99,598,501 V346L probably benign Het
Atrnl1 T A 19: 57,673,141 F518I probably benign Het
Bank1 T A 3: 136,093,366 I405F probably damaging Het
Cacna1c A G 6: 118,630,263 C1227R probably benign Het
Cacna1h A G 17: 25,388,628 L905P probably damaging Het
Cc2d1a A G 8: 84,133,836 Y826H probably benign Het
Cenpo A G 12: 4,216,643 V155A probably benign Het
Cnmd A G 14: 79,661,423 F63S probably damaging Het
Cnn3 G A 3: 121,454,951 G72D probably damaging Het
Cox10 A G 11: 64,071,713 S101P probably benign Het
Ctdsp1 T C 1: 74,394,647 V129A probably damaging Het
Cyp2d34 A T 15: 82,618,606 S140T probably benign Het
Dennd5a G A 7: 109,933,613 H317Y possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Enox1 T A 14: 77,582,436 D210E probably damaging Het
Fam171a1 A G 2: 3,197,427 N190S probably damaging Het
Fat2 T A 11: 55,253,633 K4138N possibly damaging Het
Fat4 A T 3: 38,957,474 D2241V probably damaging Het
Fbn1 C T 2: 125,403,170 V266I possibly damaging Het
Foxf2 T A 13: 31,627,205 Y376N probably damaging Het
Fras1 T A 5: 96,752,998 S3025R probably benign Het
Gba T C 3: 89,204,000 I24T probably benign Het
Gdpd5 A G 7: 99,438,333 D68G probably damaging Het
Grid1 G A 14: 34,822,619 S49N probably benign Het
Grtp1 T C 8: 13,179,639 T250A possibly damaging Het
Gucy1b1 T C 3: 82,037,988 N448D probably benign Het
H2-Ob A G 17: 34,244,126 probably benign Het
Hcn4 A G 9: 58,823,512 M1V probably null Het
Hmcn2 G A 2: 31,420,371 A3326T probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Ippk C A 13: 49,443,471 Q254K probably damaging Het
Itga2 A T 13: 114,870,614 L393I possibly damaging Het
Kcnab1 G A 3: 65,297,720 D119N probably damaging Het
Kcnip4 T A 5: 48,409,860 T122S probably benign Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Klhl22 T A 16: 17,792,589 M568K probably benign Het
Krt6a C T 15: 101,692,748 V257M probably damaging Het
Ksr2 A C 5: 117,555,225 H246P probably damaging Het
Lca5 T C 9: 83,399,753 D326G possibly damaging Het
Lcp1 A G 14: 75,214,488 E393G probably benign Het
Leo1 G A 9: 75,445,549 E125K probably benign Het
Lipt1 T A 1: 37,875,301 V146E probably damaging Het
Mael A T 1: 166,235,399 probably null Het
Mga C T 2: 119,947,961 L1996F probably damaging Het
Mllt6 A G 11: 97,678,561 N913S probably damaging Het
Mphosph9 A C 5: 124,298,759 D507E probably damaging Het
Mvp G A 7: 126,987,556 A801V probably benign Het
Ndrg2 A G 14: 51,908,662 probably benign Het
Neb T C 2: 52,292,695 D1053G possibly damaging Het
Nubp1 C A 16: 10,413,721 L79I probably benign Het
Olfr397 G A 11: 73,965,420 E271K probably benign Het
Olfr924 G A 9: 38,848,509 V132I probably benign Het
Olfr97 A C 17: 37,232,332 L13V probably benign Het
Pnpla8 G A 12: 44,283,405 V29M probably benign Het
Psmb2 T A 4: 126,707,557 I151N possibly damaging Het
Ptgs2 C T 1: 150,101,354 T104I probably benign Het
Ptpro A G 6: 137,368,079 T28A probably benign Het
Raf1 A G 6: 115,626,710 probably null Het
Ranbp2 T C 10: 58,465,529 M668T probably benign Het
Rbm48 A T 5: 3,591,760 probably null Het
Rhag A T 17: 40,831,578 T225S possibly damaging Het
Rhof A C 5: 123,131,887 L69R probably damaging Het
Slc24a5 T C 2: 125,068,804 S52P probably damaging Het
Slc8a2 T C 7: 16,141,114 V429A probably damaging Het
Slfn10-ps G A 11: 83,035,562 noncoding transcript Het
Spam1 G A 6: 24,796,887 R279H probably damaging Het
Srfbp1 A G 18: 52,487,516 D102G probably damaging Het
Srrm3 A C 5: 135,873,282 probably benign Het
Tk1 T C 11: 117,822,107 E98G probably damaging Het
Trim13 G A 14: 61,605,700 V389I probably benign Het
Ttc28 A T 5: 111,235,500 Y1289F probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt1a10 T A 1: 88,056,182 V234D probably benign Het
Vmn2r18 C A 5: 151,572,930 probably benign Het
Vmn2r75 C T 7: 86,165,367 G306E probably benign Het
Vmn2r86 C T 10: 130,453,628 V133I probably benign Het
Vps13c C A 9: 67,934,476 Q1927K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp219 T A 14: 52,006,938 T550S probably benign Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp507 G A 7: 35,802,623 probably benign Het
Zfp97 T A 17: 17,145,290 F350L possibly damaging Het
Other mutations in Kcna10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Kcna10 APN 3 107194728 missense probably damaging 1.00
IGL00481:Kcna10 APN 3 107195514 missense probably benign
IGL00645:Kcna10 APN 3 107195465 missense possibly damaging 0.95
IGL00974:Kcna10 APN 3 107195331 missense probably damaging 1.00
IGL03108:Kcna10 APN 3 107194943 missense probably benign 0.00
R0020:Kcna10 UTSW 3 107195420 missense probably damaging 1.00
R0421:Kcna10 UTSW 3 107194504 missense probably damaging 1.00
R0811:Kcna10 UTSW 3 107195259 missense possibly damaging 0.89
R2176:Kcna10 UTSW 3 107194716 missense probably damaging 1.00
R4405:Kcna10 UTSW 3 107195465 missense possibly damaging 0.95
R4668:Kcna10 UTSW 3 107194694 missense possibly damaging 0.83
R4703:Kcna10 UTSW 3 107194610 missense probably benign 0.22
R4719:Kcna10 UTSW 3 107194901 missense probably benign
R4736:Kcna10 UTSW 3 107195492 missense probably benign
R5227:Kcna10 UTSW 3 107194428 missense probably damaging 1.00
R5564:Kcna10 UTSW 3 107194229 missense probably benign
R5735:Kcna10 UTSW 3 107195078 missense probably benign
R7418:Kcna10 UTSW 3 107195046 missense probably benign 0.12
R7464:Kcna10 UTSW 3 107194079 missense probably damaging 0.99
R7699:Kcna10 UTSW 3 107195540 missense probably damaging 1.00
R7700:Kcna10 UTSW 3 107195540 missense probably damaging 1.00
R8068:Kcna10 UTSW 3 107194410 missense possibly damaging 0.58
X0026:Kcna10 UTSW 3 107195157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGCCCAGCAGAACATGTCC -3'
(R):5'- TCGTTCTCAGTCTCACGGTGGTAG -3'

Sequencing Primer
(F):5'- GCCATCCTGAGGATCATTCG -3'
(R):5'- CAGTCTCACGGTGGTAGAAGTAG -3'
Posted On2013-10-16