Incidental Mutation 'R0812:Cacna1c'
ID78471
Institutional Source Beutler Lab
Gene Symbol Cacna1c
Ensembl Gene ENSMUSG00000051331
Gene Namecalcium channel, voltage-dependent, L type, alpha 1C subunit
SynonymsCav1.2, D930026N18Rik, Cchl1a1, (alpha)1 subunit, L-type Cav1.2
MMRRC Submission 038992-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R0812 (G1)
Quality Score145
Status Not validated
Chromosome6
Chromosomal Location118587240-119196418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118630263 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1227 (C1227R)
Ref Sequence ENSEMBL: ENSMUSP00000151458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075591] [ENSMUST00000078320] [ENSMUST00000112790] [ENSMUST00000112793] [ENSMUST00000112825] [ENSMUST00000185345] [ENSMUST00000186889] [ENSMUST00000187317] [ENSMUST00000187386] [ENSMUST00000187474] [ENSMUST00000187940] [ENSMUST00000188078] [ENSMUST00000188106] [ENSMUST00000188522] [ENSMUST00000188865] [ENSMUST00000189389] [ENSMUST00000189520] [ENSMUST00000190285] [ENSMUST00000219018] [ENSMUST00000219223] [ENSMUST00000219833] [ENSMUST00000220022]
Predicted Effect probably benign
Transcript: ENSMUST00000075591
SMART Domains Protein: ENSMUSP00000075021
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
Pfam:Ion_trans 2 245 3.5e-60 PFAM
PDB:4DEY|B 246 369 2e-57 PDB
low complexity region 370 384 N/A INTRINSIC
transmembrane domain 390 409 N/A INTRINSIC
Pfam:Ion_trans 424 618 1.3e-46 PFAM
low complexity region 633 643 N/A INTRINSIC
low complexity region 663 675 N/A INTRINSIC
low complexity region 711 718 N/A INTRINSIC
transmembrane domain 762 784 N/A INTRINSIC
Pfam:Ion_trans 801 1031 2.6e-51 PFAM
Pfam:PKD_channel 1095 1348 2.7e-10 PFAM
Pfam:Ion_trans 1119 1341 3.9e-70 PFAM
Blast:EFh 1362 1390 4e-9 BLAST
Ca_chan_IQ 1476 1510 3.28e-15 SMART
low complexity region 1630 1640 N/A INTRINSIC
low complexity region 1810 1824 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078320
SMART Domains Protein: ENSMUSP00000077433
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
Pfam:Ion_trans 2 245 1.4e-59 PFAM
PDB:4DEY|B 246 344 4e-63 PDB
low complexity region 345 359 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
Pfam:Ion_trans 399 593 5.2e-46 PFAM
low complexity region 608 618 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 686 693 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
Pfam:Ion_trans 776 1006 2.5e-51 PFAM
Pfam:PKD_channel 1070 1323 1.1e-9 PFAM
Pfam:Ion_trans 1094 1316 1.5e-69 PFAM
Blast:EFh 1337 1365 4e-9 BLAST
Ca_chan_IQ 1451 1485 3.28e-15 SMART
low complexity region 1605 1615 N/A INTRINSIC
low complexity region 1785 1799 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112790
SMART Domains Protein: ENSMUSP00000108410
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
Pfam:Ion_trans 2 245 5.7e-60 PFAM
PDB:4DEY|B 246 344 4e-63 PDB
low complexity region 345 359 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
Pfam:Ion_trans 399 593 2.1e-46 PFAM
low complexity region 608 618 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 686 693 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
Pfam:Ion_trans 776 1006 1e-51 PFAM
Pfam:Ion_trans 1094 1305 1.1e-66 PFAM
Pfam:PKD_channel 1140 1312 1.3e-8 PFAM
Blast:EFh 1326 1354 4e-9 BLAST
Ca_chan_IQ 1440 1474 3.28e-15 SMART
low complexity region 1594 1604 N/A INTRINSIC
low complexity region 1774 1788 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112793
AA Change: C1386R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108413
Gene: ENSMUSG00000051331
AA Change: C1386R

DomainStartEndE-ValueType
Pfam:Ion_trans 1 257 1.8e-64 PFAM
Pfam:PKD_channel 379 624 5.8e-8 PFAM
Pfam:Ion_trans 389 630 5e-56 PFAM
low complexity region 633 643 N/A INTRINSIC
low complexity region 663 675 N/A INTRINSIC
low complexity region 711 718 N/A INTRINSIC
Pfam:Ion_trans 765 1043 8.7e-64 PFAM
Pfam:Ion_trans 1084 1411 6.4e-69 PFAM
Pfam:PKD_channel 1234 1406 9.2e-9 PFAM
Pfam:GPHH 1413 1482 7.7e-40 PFAM
Ca_chan_IQ 1534 1568 3.28e-15 SMART
Pfam:CAC1F_C 1577 2060 3.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112825
SMART Domains Protein: ENSMUSP00000108444
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
Pfam:Ion_trans 1 140 1.8e-31 PFAM
PDB:4DEY|B 141 264 1e-54 PDB
low complexity region 265 279 N/A INTRINSIC
Pfam:Ion_trans 319 513 2e-46 PFAM
low complexity region 528 538 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 606 613 N/A INTRINSIC
Pfam:Ion_trans 659 906 1e-43 PFAM
Pfam:Ion_trans 994 1205 7.1e-70 PFAM
Pfam:PKD_channel 1041 1212 1.6e-8 PFAM
Blast:EFh 1226 1254 4e-9 BLAST
Ca_chan_IQ 1340 1374 3.28e-15 SMART
low complexity region 1494 1504 N/A INTRINSIC
low complexity region 1674 1688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185345
SMART Domains Protein: ENSMUSP00000140833
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.6e-60 PFAM
PDB:4DEY|B 405 503 3e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
transmembrane domain 931 953 N/A INTRINSIC
Pfam:Ion_trans 955 1185 2.2e-50 PFAM
Pfam:PKD_channel 1250 1502 6.9e-9 PFAM
Pfam:Ion_trans 1273 1495 6.4e-65 PFAM
Blast:EFh 1516 1544 5e-9 BLAST
Ca_chan_IQ 1630 1664 2.5e-19 SMART
low complexity region 1784 1794 N/A INTRINSIC
low complexity region 1964 1978 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186889
SMART Domains Protein: ENSMUSP00000140056
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
Pfam:Ion_trans 191 434 1.5e-59 PFAM
PDB:4DEY|B 435 533 5e-63 PDB
low complexity region 534 548 N/A INTRINSIC
Pfam:Ion_trans 588 782 5.6e-46 PFAM
low complexity region 797 807 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 875 882 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
Pfam:Ion_trans 965 1195 2.7e-51 PFAM
Pfam:PKD_channel 1261 1512 1.3e-9 PFAM
Pfam:Ion_trans 1283 1505 1.7e-69 PFAM
Blast:EFh 1526 1554 5e-9 BLAST
Ca_chan_IQ 1640 1674 3.28e-15 SMART
low complexity region 1794 1804 N/A INTRINSIC
low complexity region 1974 1988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187317
SMART Domains Protein: ENSMUSP00000140693
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.8e-60 PFAM
PDB:4DEY|B 405 503 2e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.5e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
transmembrane domain 931 953 N/A INTRINSIC
Pfam:Ion_trans 955 1185 2.3e-50 PFAM
Pfam:PKD_channel 1249 1530 8.3e-8 PFAM
Pfam:Ion_trans 1273 1326 5e-16 PFAM
Pfam:Ion_trans 1323 1523 2.5e-56 PFAM
Blast:EFh 1544 1572 5e-9 BLAST
Ca_chan_IQ 1658 1692 2.5e-19 SMART
low complexity region 1812 1822 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187386
SMART Domains Protein: ENSMUSP00000140341
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
transmembrane domain 96 118 N/A INTRINSIC
Pfam:Ion_trans 132 375 8.5e-60 PFAM
PDB:4DEY|B 376 499 1e-57 PDB
low complexity region 500 514 N/A INTRINSIC
transmembrane domain 520 539 N/A INTRINSIC
Pfam:Ion_trans 554 748 1.4e-44 PFAM
low complexity region 763 773 N/A INTRINSIC
low complexity region 793 805 N/A INTRINSIC
low complexity region 841 848 N/A INTRINSIC
transmembrane domain 892 914 N/A INTRINSIC
Pfam:Ion_trans 931 1161 2.9e-49 PFAM
Pfam:PKD_channel 1226 1478 6.8e-9 PFAM
Pfam:Ion_trans 1249 1471 6.3e-65 PFAM
Blast:EFh 1492 1520 4e-9 BLAST
Ca_chan_IQ 1606 1640 2.5e-19 SMART
low complexity region 1760 1770 N/A INTRINSIC
low complexity region 1940 1954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187474
SMART Domains Protein: ENSMUSP00000140961
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
Pfam:Ion_trans 191 434 7.6e-60 PFAM
PDB:4DEY|B 435 533 4e-63 PDB
low complexity region 534 548 N/A INTRINSIC
Pfam:Ion_trans 588 782 2.8e-46 PFAM
low complexity region 797 807 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 875 882 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
Pfam:Ion_trans 965 1195 5.6e-51 PFAM
Pfam:PKD_channel 1261 1512 7.3e-10 PFAM
Pfam:Ion_trans 1283 1505 8.3e-70 PFAM
Blast:EFh 1526 1554 5e-9 BLAST
Ca_chan_IQ 1640 1674 3.28e-15 SMART
low complexity region 1794 1804 N/A INTRINSIC
low complexity region 1974 1988 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187849
Predicted Effect probably benign
Transcript: ENSMUST00000187940
SMART Domains Protein: ENSMUSP00000141033
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
Pfam:Ion_trans 191 434 7.6e-60 PFAM
PDB:4DEY|B 435 533 4e-63 PDB
low complexity region 534 548 N/A INTRINSIC
Pfam:Ion_trans 588 782 2.8e-46 PFAM
low complexity region 797 807 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 875 882 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
Pfam:Ion_trans 965 1195 5.6e-51 PFAM
Pfam:PKD_channel 1260 1512 5.8e-11 PFAM
Pfam:Ion_trans 1283 1505 1.2e-66 PFAM
Blast:EFh 1526 1554 5e-9 BLAST
Ca_chan_IQ 1640 1674 3.28e-15 SMART
low complexity region 1794 1804 N/A INTRINSIC
low complexity region 1974 1988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188078
SMART Domains Protein: ENSMUSP00000140415
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.5e-60 PFAM
PDB:4DEY|B 405 503 5e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 6.9e-50 PFAM
Pfam:PKD_channel 1230 1482 9e-8 PFAM
Pfam:Ion_trans 1253 1475 4.3e-68 PFAM
Blast:EFh 1496 1524 4e-9 BLAST
Ca_chan_IQ 1610 1644 2.5e-19 SMART
low complexity region 1764 1774 N/A INTRINSIC
low complexity region 1944 1958 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188106
SMART Domains Protein: ENSMUSP00000140886
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.5e-62 PFAM
PDB:4DEY|B 405 528 2e-57 PDB
low complexity region 529 543 N/A INTRINSIC
Pfam:Ion_trans 583 777 1.4e-46 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 870 877 N/A INTRINSIC
transmembrane domain 921 943 N/A INTRINSIC
Pfam:Ion_trans 960 1190 2.9e-51 PFAM
Pfam:Ion_trans 1278 1489 5.2e-70 PFAM
Pfam:PKD_channel 1325 1496 4.8e-9 PFAM
Blast:EFh 1510 1538 5e-9 BLAST
Ca_chan_IQ 1624 1658 3.28e-15 SMART
low complexity region 1778 1788 N/A INTRINSIC
low complexity region 1958 1972 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188181
Predicted Effect probably benign
Transcript: ENSMUST00000188522
SMART Domains Protein: ENSMUSP00000140920
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.7e-60 PFAM
PDB:4DEY|B 405 528 2e-57 PDB
low complexity region 529 543 N/A INTRINSIC
transmembrane domain 549 568 N/A INTRINSIC
Pfam:Ion_trans 583 777 1.4e-44 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 870 877 N/A INTRINSIC
transmembrane domain 921 943 N/A INTRINSIC
Pfam:Ion_trans 960 1190 2.9e-49 PFAM
Pfam:PKD_channel 1255 1507 7e-9 PFAM
Pfam:Ion_trans 1278 1500 6.4e-65 PFAM
Blast:EFh 1521 1549 5e-9 BLAST
Ca_chan_IQ 1635 1669 2.5e-19 SMART
low complexity region 1789 1799 N/A INTRINSIC
low complexity region 1969 1983 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188865
SMART Domains Protein: ENSMUSP00000139981
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.5e-60 PFAM
PDB:4DEY|B 405 503 5e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 6.9e-50 PFAM
Pfam:PKD_channel 1230 1482 6.8e-9 PFAM
Pfam:Ion_trans 1253 1475 6.3e-65 PFAM
Blast:EFh 1496 1524 4e-9 BLAST
Ca_chan_IQ 1610 1644 2.5e-19 SMART
low complexity region 1764 1774 N/A INTRINSIC
low complexity region 1944 1958 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189389
SMART Domains Protein: ENSMUSP00000139855
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.7e-60 PFAM
PDB:4DEY|B 405 503 4e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.5e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 3e-49 PFAM
Pfam:PKD_channel 1229 1510 8.2e-8 PFAM
Pfam:Ion_trans 1253 1306 5e-16 PFAM
Pfam:Ion_trans 1303 1503 2.5e-56 PFAM
Blast:EFh 1524 1552 5e-9 BLAST
Ca_chan_IQ 1638 1672 2.5e-19 SMART
low complexity region 1792 1802 N/A INTRINSIC
low complexity region 1972 1986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189520
SMART Domains Protein: ENSMUSP00000140220
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.6e-60 PFAM
PDB:4DEY|B 405 503 4e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 7e-50 PFAM
Pfam:PKD_channel 1229 1499 2.2e-9 PFAM
Pfam:Ion_trans 1253 1305 6.6e-16 PFAM
Pfam:Ion_trans 1301 1492 1.1e-56 PFAM
Blast:EFh 1513 1541 5e-9 BLAST
Ca_chan_IQ 1627 1661 2.5e-19 SMART
low complexity region 1781 1791 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190285
SMART Domains Protein: ENSMUSP00000141015
Gene: ENSMUSG00000051331

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
Pfam:Ion_trans 191 434 4e-58 PFAM
PDB:4DEY|B 435 558 2e-57 PDB
low complexity region 559 573 N/A INTRINSIC
transmembrane domain 579 598 N/A INTRINSIC
Pfam:Ion_trans 613 807 1.5e-44 PFAM
low complexity region 822 832 N/A INTRINSIC
low complexity region 852 864 N/A INTRINSIC
low complexity region 900 907 N/A INTRINSIC
transmembrane domain 951 973 N/A INTRINSIC
Pfam:Ion_trans 990 1220 3e-49 PFAM
Pfam:PKD_channel 1285 1537 1.4e-7 PFAM
Pfam:Ion_trans 1308 1530 4.4e-68 PFAM
Blast:EFh 1551 1579 5e-9 BLAST
Ca_chan_IQ 1665 1699 2.5e-19 SMART
low complexity region 1819 1829 N/A INTRINSIC
low complexity region 1999 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219018
Predicted Effect probably benign
Transcript: ENSMUST00000219223
Predicted Effect probably benign
Transcript: ENSMUST00000219833
Predicted Effect probably benign
Transcript: ENSMUST00000220022
AA Change: C1227R

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.8%
  • 20x: 91.7%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha-1 subunit of a voltage-dependent calcium channel. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization. The alpha-1 subunit consists of 24 transmembrane segments and forms the pore through which ions pass into the cell. The calcium channel consists of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. There are multiple isoforms of each of these proteins, either encoded by different genes or the result of alternative splicing of transcripts. The protein encoded by this gene binds to and is inhibited by dihydropyridine. Alternative splicing results in many transcript variants encoding different proteins. Some of the predicted proteins may not produce functional ion channel subunits. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for mutations that inactivate the gene do not survive to term. Selective ablation in beta cells resulted in impaired insulin secretion and systemic glucose intolerance. Heterozygotes were hypoactive, showed increased anxiety, and poor motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,713,414 F858S probably damaging Het
Abcb1a T C 5: 8,713,229 S586P probably damaging Het
Abcc3 G A 11: 94,375,202 probably benign Het
Ap5z1 G A 5: 142,475,791 R583H probably benign Het
Arrb1 G T 7: 99,598,501 V346L probably benign Het
Atrnl1 T A 19: 57,673,141 F518I probably benign Het
Bank1 T A 3: 136,093,366 I405F probably damaging Het
Cacna1h A G 17: 25,388,628 L905P probably damaging Het
Cc2d1a A G 8: 84,133,836 Y826H probably benign Het
Cenpo A G 12: 4,216,643 V155A probably benign Het
Cnmd A G 14: 79,661,423 F63S probably damaging Het
Cnn3 G A 3: 121,454,951 G72D probably damaging Het
Cox10 A G 11: 64,071,713 S101P probably benign Het
Ctdsp1 T C 1: 74,394,647 V129A probably damaging Het
Cyp2d34 A T 15: 82,618,606 S140T probably benign Het
Dennd5a G A 7: 109,933,613 H317Y possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Enox1 T A 14: 77,582,436 D210E probably damaging Het
Fam171a1 A G 2: 3,197,427 N190S probably damaging Het
Fat2 T A 11: 55,253,633 K4138N possibly damaging Het
Fat4 A T 3: 38,957,474 D2241V probably damaging Het
Fbn1 C T 2: 125,403,170 V266I possibly damaging Het
Foxf2 T A 13: 31,627,205 Y376N probably damaging Het
Fras1 T A 5: 96,752,998 S3025R probably benign Het
Gba T C 3: 89,204,000 I24T probably benign Het
Gdpd5 A G 7: 99,438,333 D68G probably damaging Het
Grid1 G A 14: 34,822,619 S49N probably benign Het
Grtp1 T C 8: 13,179,639 T250A possibly damaging Het
Gucy1b1 T C 3: 82,037,988 N448D probably benign Het
H2-Ob A G 17: 34,244,126 probably benign Het
Hcn4 A G 9: 58,823,512 M1V probably null Het
Hmcn2 G A 2: 31,420,371 A3326T probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Ippk C A 13: 49,443,471 Q254K probably damaging Het
Itga2 A T 13: 114,870,614 L393I possibly damaging Het
Kcna10 A T 3: 107,195,259 E402V possibly damaging Het
Kcnab1 G A 3: 65,297,720 D119N probably damaging Het
Kcnip4 T A 5: 48,409,860 T122S probably benign Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Klhl22 T A 16: 17,792,589 M568K probably benign Het
Krt6a C T 15: 101,692,748 V257M probably damaging Het
Ksr2 A C 5: 117,555,225 H246P probably damaging Het
Lca5 T C 9: 83,399,753 D326G possibly damaging Het
Lcp1 A G 14: 75,214,488 E393G probably benign Het
Leo1 G A 9: 75,445,549 E125K probably benign Het
Lipt1 T A 1: 37,875,301 V146E probably damaging Het
Mael A T 1: 166,235,399 probably null Het
Mga C T 2: 119,947,961 L1996F probably damaging Het
Mllt6 A G 11: 97,678,561 N913S probably damaging Het
Mphosph9 A C 5: 124,298,759 D507E probably damaging Het
Mvp G A 7: 126,987,556 A801V probably benign Het
Ndrg2 A G 14: 51,908,662 probably benign Het
Neb T C 2: 52,292,695 D1053G possibly damaging Het
Nubp1 C A 16: 10,413,721 L79I probably benign Het
Olfr397 G A 11: 73,965,420 E271K probably benign Het
Olfr924 G A 9: 38,848,509 V132I probably benign Het
Olfr97 A C 17: 37,232,332 L13V probably benign Het
Pnpla8 G A 12: 44,283,405 V29M probably benign Het
Psmb2 T A 4: 126,707,557 I151N possibly damaging Het
Ptgs2 C T 1: 150,101,354 T104I probably benign Het
Ptpro A G 6: 137,368,079 T28A probably benign Het
Raf1 A G 6: 115,626,710 probably null Het
Ranbp2 T C 10: 58,465,529 M668T probably benign Het
Rbm48 A T 5: 3,591,760 probably null Het
Rhag A T 17: 40,831,578 T225S possibly damaging Het
Rhof A C 5: 123,131,887 L69R probably damaging Het
Slc24a5 T C 2: 125,068,804 S52P probably damaging Het
Slc8a2 T C 7: 16,141,114 V429A probably damaging Het
Slfn10-ps G A 11: 83,035,562 noncoding transcript Het
Spam1 G A 6: 24,796,887 R279H probably damaging Het
Srfbp1 A G 18: 52,487,516 D102G probably damaging Het
Srrm3 A C 5: 135,873,282 probably benign Het
Tk1 T C 11: 117,822,107 E98G probably damaging Het
Trim13 G A 14: 61,605,700 V389I probably benign Het
Ttc28 A T 5: 111,235,500 Y1289F probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt1a10 T A 1: 88,056,182 V234D probably benign Het
Vmn2r18 C A 5: 151,572,930 probably benign Het
Vmn2r75 C T 7: 86,165,367 G306E probably benign Het
Vmn2r86 C T 10: 130,453,628 V133I probably benign Het
Vps13c C A 9: 67,934,476 Q1927K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp219 T A 14: 52,006,938 T550S probably benign Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp507 G A 7: 35,802,623 probably benign Het
Zfp97 T A 17: 17,145,290 F350L possibly damaging Het
Other mutations in Cacna1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Cacna1c APN 6 118676444 splice site probably benign
IGL00990:Cacna1c APN 6 118613295 missense probably damaging 1.00
IGL01352:Cacna1c APN 6 118656557 nonsense probably null
IGL01922:Cacna1c APN 6 118652668 missense probably damaging 0.99
IGL02008:Cacna1c APN 6 118715924 missense probably null 0.25
IGL02049:Cacna1c APN 6 118603919 missense probably benign 0.34
IGL02320:Cacna1c APN 6 118637792 missense probably damaging 1.00
IGL02375:Cacna1c APN 6 118675923 missense probably damaging 1.00
IGL02454:Cacna1c APN 6 118602180 missense probably damaging 1.00
IGL02544:Cacna1c APN 6 118751479 missense probably damaging 1.00
IGL02648:Cacna1c APN 6 118757496 missense probably damaging 1.00
IGL03191:Cacna1c APN 6 118741903 missense probably damaging 1.00
PIT4418001:Cacna1c UTSW 6 118654423 missense
PIT4469001:Cacna1c UTSW 6 118595972 missense unknown
R0041:Cacna1c UTSW 6 118594027 missense probably damaging 0.99
R0062:Cacna1c UTSW 6 118602237 missense probably damaging 1.00
R0062:Cacna1c UTSW 6 118602237 missense probably damaging 1.00
R0083:Cacna1c UTSW 6 118625523 missense probably damaging 1.00
R0131:Cacna1c UTSW 6 118625512 missense probably damaging 1.00
R0142:Cacna1c UTSW 6 118603882 missense probably damaging 1.00
R0193:Cacna1c UTSW 6 118602402 splice site probably benign
R0245:Cacna1c UTSW 6 118604454 missense probably benign 0.10
R0394:Cacna1c UTSW 6 118625497 missense probably damaging 1.00
R0555:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0617:Cacna1c UTSW 6 118602213 missense probably damaging 1.00
R0652:Cacna1c UTSW 6 118602229 missense probably damaging 1.00
R0730:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0828:Cacna1c UTSW 6 118757386 missense probably benign 0.24
R0837:Cacna1c UTSW 6 118630270 nonsense probably null
R0881:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0882:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0924:Cacna1c UTSW 6 118675896 missense probably damaging 1.00
R0930:Cacna1c UTSW 6 118675896 missense probably damaging 1.00
R1157:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1158:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1159:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1160:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1237:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1238:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1239:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1337:Cacna1c UTSW 6 118627455 missense probably damaging 1.00
R1433:Cacna1c UTSW 6 118652793 nonsense probably null
R1463:Cacna1c UTSW 6 118593994 missense probably benign 0.27
R1517:Cacna1c UTSW 6 118598759 missense probably benign 0.01
R1619:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1704:Cacna1c UTSW 6 118602146 missense probably benign 0.01
R1739:Cacna1c UTSW 6 118610544 missense probably damaging 0.99
R1804:Cacna1c UTSW 6 118687046 missense probably damaging 1.00
R1889:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1891:Cacna1c UTSW 6 118776519 missense probably damaging 1.00
R1895:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1944:Cacna1c UTSW 6 118606266 missense probably damaging 1.00
R1961:Cacna1c UTSW 6 118630322 missense probably benign 0.05
R2043:Cacna1c UTSW 6 118596088 missense probably benign 0.01
R2045:Cacna1c UTSW 6 118656137 missense probably damaging 1.00
R2217:Cacna1c UTSW 6 118670407 missense probably damaging 1.00
R2237:Cacna1c UTSW 6 118652743 missense possibly damaging 0.94
R2509:Cacna1c UTSW 6 118734982 missense probably damaging 1.00
R3157:Cacna1c UTSW 6 118751524 missense probably benign 0.00
R3739:Cacna1c UTSW 6 118741952 missense probably benign
R3831:Cacna1c UTSW 6 118604463 missense probably benign 0.06
R4319:Cacna1c UTSW 6 118654369 missense probably damaging 1.00
R4477:Cacna1c UTSW 6 118630239 missense possibly damaging 0.48
R4571:Cacna1c UTSW 6 118630380 missense probably benign
R4671:Cacna1c UTSW 6 118652058 missense probably damaging 1.00
R4729:Cacna1c UTSW 6 118656175 missense probably damaging 1.00
R4741:Cacna1c UTSW 6 118613310 missense probably damaging 1.00
R4798:Cacna1c UTSW 6 118630302 nonsense probably null
R4803:Cacna1c UTSW 6 118751541 missense probably damaging 0.99
R4821:Cacna1c UTSW 6 118696425 missense probably damaging 1.00
R4888:Cacna1c UTSW 6 118751439 missense probably damaging 1.00
R4981:Cacna1c UTSW 6 118751471 missense probably benign 0.00
R5253:Cacna1c UTSW 6 118597969 missense probably benign 0.01
R5297:Cacna1c UTSW 6 118742361 missense probably damaging 1.00
R5345:Cacna1c UTSW 6 118656536 critical splice donor site probably null
R5364:Cacna1c UTSW 6 118656543 missense probably benign 0.35
R5439:Cacna1c UTSW 6 118654372 missense probably damaging 1.00
R5472:Cacna1c UTSW 6 118638446 missense possibly damaging 0.86
R5516:Cacna1c UTSW 6 119057218 missense probably damaging 1.00
R5590:Cacna1c UTSW 6 118687182 missense probably damaging 1.00
R5619:Cacna1c UTSW 6 118742361 missense probably damaging 1.00
R5684:Cacna1c UTSW 6 118687044 missense probably damaging 1.00
R5737:Cacna1c UTSW 6 118741932 missense probably damaging 1.00
R5768:Cacna1c UTSW 6 118697680 missense probably damaging 1.00
R5933:Cacna1c UTSW 6 118612580 missense probably damaging 1.00
R5965:Cacna1c UTSW 6 118602300 missense probably damaging 1.00
R6114:Cacna1c UTSW 6 118596140 missense probably benign 0.07
R6161:Cacna1c UTSW 6 119057302 missense probably damaging 1.00
R6267:Cacna1c UTSW 6 118598723 missense possibly damaging 0.52
R6267:Cacna1c UTSW 6 118652714 missense probably benign 0.09
R6296:Cacna1c UTSW 6 118598723 missense possibly damaging 0.52
R6296:Cacna1c UTSW 6 118652714 missense probably benign 0.09
R6307:Cacna1c UTSW 6 118613953 missense probably damaging 0.97
R6431:Cacna1c UTSW 6 118751373 missense probably damaging 1.00
R6467:Cacna1c UTSW 6 118652710 missense probably damaging 1.00
R7026:Cacna1c UTSW 6 118637771 missense probably damaging 1.00
R7049:Cacna1c UTSW 6 118601163 missense probably benign 0.35
R7072:Cacna1c UTSW 6 118596106 missense
R7192:Cacna1c UTSW 6 118656249 missense
R7243:Cacna1c UTSW 6 118637729 critical splice donor site probably null
R7250:Cacna1c UTSW 6 118598005 missense
R7250:Cacna1c UTSW 6 118696451 missense
R7264:Cacna1c UTSW 6 118602195 missense
R7312:Cacna1c UTSW 6 119057211 missense
R7392:Cacna1c UTSW 6 118741920 missense
R7401:Cacna1c UTSW 6 119052708 critical splice acceptor site probably null
R7449:Cacna1c UTSW 6 118602349 missense
R7451:Cacna1c UTSW 6 118594020 missense unknown
R7491:Cacna1c UTSW 6 118613343 missense
R7507:Cacna1c UTSW 6 119057239 missense
R7573:Cacna1c UTSW 6 118604445 missense
R7702:Cacna1c UTSW 6 118598766 missense
R7745:Cacna1c UTSW 6 119052626 missense
R7834:Cacna1c UTSW 6 118610581 missense
R7867:Cacna1c UTSW 6 118776446 missense
R7917:Cacna1c UTSW 6 118610581 missense
R7950:Cacna1c UTSW 6 118776446 missense
X0065:Cacna1c UTSW 6 118657376 missense probably damaging 1.00
Z1176:Cacna1c UTSW 6 118697737 missense
Z1177:Cacna1c UTSW 6 118757661 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCTTCCACACAAAGCTTGGGGTAAG -3'
(R):5'- TTTCACGCACAACCAGAGGTGGTC -3'

Sequencing Primer
(F):5'- AAGCTTGGGGTAAGCTAGTCATC -3'
(R):5'- AGAATACCAGGCTCTTCGTTG -3'
Posted On2013-10-16