Mutagenetix > Incidental Mutation

Incidental Mutation 'R0812:Lca5'

78482

Institutional Source

Beutler Lab

Gene Symbol

Lca5

Ensembl Gene

ENSMUSG00000032258

Gene Name

Leber congenital amaurosis 5 (human)

Synonyms

4930431B11Rik, 5730406O13Rik, ORF64

MMRRC Submission

038992-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.483) question?

Stock #

R0812 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83390293-83441127 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83399753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 326 (D326G)

Ref Sequence

ENSEMBL: ENSMUSP00000034791 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034791] [ENSMUST00000034793] [ENSMUST00000190514]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034791
AA Change: D326G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000034791
Gene: ENSMUSG00000032258
AA Change: D326G

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
Pfam:Lebercilin	103	295	2.6e-66	PFAM
low complexity region	306	315	N/A	INTRINSIC
low complexity region	617	627	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034793
AA Change: D326G

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000034793
Gene: ENSMUSG00000032258
AA Change: D326G

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
Pfam:Lebercilin	102	295	4.8e-71	PFAM
low complexity region	306	315	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190514
AA Change: D326G

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140753
Gene: ENSMUSG00000032258
AA Change: D326G

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
Pfam:Lebercilin	102	295	5.8e-71	PFAM
low complexity region	306	315	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191225

Meta Mutation Damage Score

0.0924

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.8%
20x: 91.7%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is thought to be involved in centrosomal or ciliary functions. Mutations in this gene cause Leber congenital amaurosis type V. Alternatively spliced transcript variants are described. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit retinal patches of depigmentation, lack rod and cone ERG responses to light stimuli, and show loss of ciliary intraflagellar transport function in photoreceptors leading to failure of outer segment formation and photoreceptor degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	G	2: 130,713,414	F858S	probably damaging	Het
Abcb1a	T	C	5: 8,713,229	S586P	probably damaging	Het
Abcc3	G	A	11: 94,375,202		probably benign	Het
Ap5z1	G	A	5: 142,475,791	R583H	probably benign	Het
Arrb1	G	T	7: 99,598,501	V346L	probably benign	Het
Atrnl1	T	A	19: 57,673,141	F518I	probably benign	Het
Bank1	T	A	3: 136,093,366	I405F	probably damaging	Het
Cacna1c	A	G	6: 118,630,263	C1227R	probably benign	Het
Cacna1h	A	G	17: 25,388,628	L905P	probably damaging	Het
Cc2d1a	A	G	8: 84,133,836	Y826H	probably benign	Het
Cenpo	A	G	12: 4,216,643	V155A	probably benign	Het
Cnmd	A	G	14: 79,661,423	F63S	probably damaging	Het
Cnn3	G	A	3: 121,454,951	G72D	probably damaging	Het
Cox10	A	G	11: 64,071,713	S101P	probably benign	Het
Ctdsp1	T	C	1: 74,394,647	V129A	probably damaging	Het
Cyp2d34	A	T	15: 82,618,606	S140T	probably benign	Het
Dennd5a	G	A	7: 109,933,613	H317Y	possibly damaging	Het
Eef2	C	CN	10: 81,178,769		probably null	Het
Enox1	T	A	14: 77,582,436	D210E	probably damaging	Het
Fam171a1	A	G	2: 3,197,427	N190S	probably damaging	Het
Fat2	T	A	11: 55,253,633	K4138N	possibly damaging	Het
Fat4	A	T	3: 38,957,474	D2241V	probably damaging	Het
Fbn1	C	T	2: 125,403,170	V266I	possibly damaging	Het
Foxf2	T	A	13: 31,627,205	Y376N	probably damaging	Het
Fras1	T	A	5: 96,752,998	S3025R	probably benign	Het
Gba	T	C	3: 89,204,000	I24T	probably benign	Het
Gdpd5	A	G	7: 99,438,333	D68G	probably damaging	Het
Grid1	G	A	14: 34,822,619	S49N	probably benign	Het
Grtp1	T	C	8: 13,179,639	T250A	possibly damaging	Het
Gucy1b1	T	C	3: 82,037,988	N448D	probably benign	Het
H2-Ob	A	G	17: 34,244,126		probably benign	Het
Hcn4	A	G	9: 58,823,512	M1V	probably null	Het
Hmcn2	G	A	2: 31,420,371	A3326T	probably damaging	Het
Impg2	TACCACCACCACCACCACCACCACCA	TACCACCACCACCACCACCACCA	16: 56,257,939		probably benign	Het
Ippk	C	A	13: 49,443,471	Q254K	probably damaging	Het
Itga2	A	T	13: 114,870,614	L393I	possibly damaging	Het
Kcna10	A	T	3: 107,195,259	E402V	possibly damaging	Het
Kcnab1	G	A	3: 65,297,720	D119N	probably damaging	Het
Kcnip4	T	A	5: 48,409,860	T122S	probably benign	Het
Kcnma1	G	A	14: 23,300,018	P1151L	probably damaging	Het
Klhl22	T	A	16: 17,792,589	M568K	probably benign	Het
Krt6a	C	T	15: 101,692,748	V257M	probably damaging	Het
Ksr2	A	C	5: 117,555,225	H246P	probably damaging	Het
Lcp1	A	G	14: 75,214,488	E393G	probably benign	Het
Leo1	G	A	9: 75,445,549	E125K	probably benign	Het
Lipt1	T	A	1: 37,875,301	V146E	probably damaging	Het
Mael	A	T	1: 166,235,399		probably null	Het
Mga	C	T	2: 119,947,961	L1996F	probably damaging	Het
Mllt6	A	G	11: 97,678,561	N913S	probably damaging	Het
Mphosph9	A	C	5: 124,298,759	D507E	probably damaging	Het
Mvp	G	A	7: 126,987,556	A801V	probably benign	Het
Ndrg2	A	G	14: 51,908,662		probably benign	Het
Neb	T	C	2: 52,292,695	D1053G	possibly damaging	Het
Nubp1	C	A	16: 10,413,721	L79I	probably benign	Het
Olfr397	G	A	11: 73,965,420	E271K	probably benign	Het
Olfr924	G	A	9: 38,848,509	V132I	probably benign	Het
Olfr97	A	C	17: 37,232,332	L13V	probably benign	Het
Pnpla8	G	A	12: 44,283,405	V29M	probably benign	Het
Psmb2	T	A	4: 126,707,557	I151N	possibly damaging	Het
Ptgs2	C	T	1: 150,101,354	T104I	probably benign	Het
Ptpro	A	G	6: 137,368,079	T28A	probably benign	Het
Raf1	A	G	6: 115,626,710		probably null	Het
Ranbp2	T	C	10: 58,465,529	M668T	probably benign	Het
Rbm48	A	T	5: 3,591,760		probably null	Het
Rhag	A	T	17: 40,831,578	T225S	possibly damaging	Het
Rhof	A	C	5: 123,131,887	L69R	probably damaging	Het
Slc24a5	T	C	2: 125,068,804	S52P	probably damaging	Het
Slc8a2	T	C	7: 16,141,114	V429A	probably damaging	Het
Slfn10-ps	G	A	11: 83,035,562		noncoding transcript	Het
Spam1	G	A	6: 24,796,887	R279H	probably damaging	Het
Srfbp1	A	G	18: 52,487,516	D102G	probably damaging	Het
Srrm3	A	C	5: 135,873,282		probably benign	Het
Tk1	T	C	11: 117,822,107	E98G	probably damaging	Het
Trim13	G	A	14: 61,605,700	V389I	probably benign	Het
Ttc28	A	T	5: 111,235,500	Y1289F	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ugt1a10	T	A	1: 88,056,182	V234D	probably benign	Het
Vmn2r18	C	A	5: 151,572,930		probably benign	Het
Vmn2r75	C	T	7: 86,165,367	G306E	probably benign	Het
Vmn2r86	C	T	10: 130,453,628	V133I	probably benign	Het
Vps13c	C	A	9: 67,934,476	Q1927K	probably benign	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp219	T	A	14: 52,006,938	T550S	probably benign	Het
Zfp329	T	A	7: 12,811,468	N43I	probably benign	Het
Zfp507	G	A	7: 35,802,623		probably benign	Het
Zfp97	T	A	17: 17,145,290	F350L	possibly damaging	Het

Other mutations in Lca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01073:Lca5	APN	9	83395475	missense	probably damaging	0.98
IGL01349:Lca5	APN	9	83426617	missense	probably damaging	1.00
IGL01918:Lca5	APN	9	83423148	missense	probably damaging	1.00
IGL02035:Lca5	APN	9	83423312	missense	probably damaging	1.00
IGL02276:Lca5	APN	9	83398585	missense	possibly damaging	0.79
IGL02425:Lca5	APN	9	83399721	missense	probably damaging	1.00
IGL02481:Lca5	APN	9	83423117	missense	probably damaging	1.00
IGL02483:Lca5	APN	9	83423117	missense	probably damaging	1.00
R0465:Lca5	UTSW	9	83395867	nonsense	probably null
R0610:Lca5	UTSW	9	83399739	missense	probably benign	0.24
R0811:Lca5	UTSW	9	83399753	missense	possibly damaging	0.95
R0968:Lca5	UTSW	9	83423169	missense	probably benign	0.01
R1891:Lca5	UTSW	9	83395608	missense	probably damaging	1.00
R5223:Lca5	UTSW	9	83398613	missense	probably benign	0.00
R5235:Lca5	UTSW	9	83423054	nonsense	probably null
R5260:Lca5	UTSW	9	83423223	missense	probably damaging	0.98
R5531:Lca5	UTSW	9	83398595	missense	probably benign	0.00
R5558:Lca5	UTSW	9	83401743	missense	probably damaging	0.99
R5688:Lca5	UTSW	9	83398566	missense	probably benign	0.01
R5886:Lca5	UTSW	9	83399681	missense	probably benign	0.31
R6426:Lca5	UTSW	9	83395654	nonsense	probably null
R7108:Lca5	UTSW	9	83423169	missense	probably benign	0.25
R7151:Lca5	UTSW	9	83398640	missense	probably benign	0.20
R7314:Lca5	UTSW	9	83395510	missense	possibly damaging	0.86
R7378:Lca5	UTSW	9	83395530	missense	probably benign	0.00
R7468:Lca5	UTSW	9	83423456	missense	probably damaging	0.99
R7686:Lca5	UTSW	9	83395239	missense	probably benign	0.00
R8874:Lca5	UTSW	9	83395450	missense	probably damaging	1.00
R8934:Lca5	UTSW	9	83391856	utr 3 prime	probably benign
R8987:Lca5	UTSW	9	83401743	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGTCATTGTGCTAAACTCACCG -3'
(R):5'- GAAGCACCTACCTCTCACAGTTGC -3'

Sequencing Primer
(F):5'- CCGAAGAGAGATATTCTGGTTCATCC -3'
(R):5'- caaatcccaaatagcattcacttc -3'

Posted On

2013-10-16