Incidental Mutation 'R0811:Hmcn2'
ID 78505
Institutional Source Beutler Lab
Gene Symbol Hmcn2
Ensembl Gene ENSMUSG00000055632
Gene Name hemicentin 2
Synonyms
MMRRC Submission 038991-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0811 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 31204427-31350750 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 31310383 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 3326 (A3326T)
Ref Sequence ENSEMBL: ENSMUSP00000109160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113532] [ENSMUST00000226996]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000113532
AA Change: A3326T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109160
Gene: ENSMUSG00000055632
AA Change: A3326T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 37 211 1.21e-1 SMART
Blast:IG_like 263 340 2e-38 BLAST
IG 434 515 7.36e-2 SMART
IGc2 530 595 1.91e-9 SMART
IGc2 621 685 4.81e-15 SMART
IGc2 711 773 1.09e-13 SMART
IGc2 799 866 2.72e-14 SMART
IGc2 894 959 1.95e-15 SMART
IGc2 985 1049 5e-13 SMART
IGc2 1082 1147 1.09e-13 SMART
low complexity region 1151 1169 N/A INTRINSIC
IGc2 1173 1232 7.07e-13 SMART
IGc2 1260 1326 4.31e-17 SMART
IGc2 1354 1428 3e-16 SMART
IGc2 1456 1522 1.82e-15 SMART
IGc2 1550 1615 2.7e-18 SMART
IGc2 1644 1708 1.3e-11 SMART
IGc2 1736 1801 6.69e-14 SMART
IG 1826 1917 2.31e0 SMART
IGc2 1932 1997 4.62e-17 SMART
IGc2 2024 2091 3.25e-12 SMART
IGc2 2117 2182 1.28e-10 SMART
IGc2 2209 2276 3.76e-8 SMART
IGc2 2305 2370 2.6e-11 SMART
IGc2 2399 2464 1.32e-12 SMART
IGc2 2492 2557 2.06e-14 SMART
IGc2 2588 2653 3.9e-15 SMART
IGc2 2686 2751 2.64e-12 SMART
IGc2 2797 2862 9.05e-11 SMART
IGc2 2892 2957 4.7e-9 SMART
IGc2 2984 3049 1.44e-13 SMART
IGc2 3079 3144 9.33e-13 SMART
IGc2 3171 3236 3.79e-13 SMART
IGc2 3264 3331 1.85e-16 SMART
IGc2 3360 3425 9.61e-15 SMART
low complexity region 3433 3445 N/A INTRINSIC
IGc2 3453 3514 5.83e-14 SMART
IGc2 3542 3600 1.76e-8 SMART
low complexity region 3613 3627 N/A INTRINSIC
IGc2 3628 3693 5.2e-11 SMART
IGc2 3719 3784 2.64e-12 SMART
IGc2 3810 3877 3.35e-5 SMART
IGc2 3903 3968 3.73e-12 SMART
IGc2 3994 4058 4.39e-9 SMART
IGc2 4084 4149 1.79e-14 SMART
low complexity region 4157 4169 N/A INTRINSIC
IGc2 4175 4238 9.33e-13 SMART
IGc2 4265 4329 7.22e-19 SMART
IGc2 4355 4419 1.59e-15 SMART
Pfam:G2F 4431 4613 1.7e-56 PFAM
EGF_CA 4668 4708 5.78e-11 SMART
EGF_CA 4709 4753 9.39e-11 SMART
EGF_CA 4754 4796 7.69e-7 SMART
EGF_CA 4797 4837 2.19e-11 SMART
EGF_CA 4904 4943 6.74e-12 SMART
EGF_like 4944 4989 1.87e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226996
Meta Mutation Damage Score 0.0916 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,763,229 (GRCm39) S586P probably damaging Het
Ap5z1 G A 5: 142,461,546 (GRCm39) R583H probably benign Het
Arhgap28 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG 17: 68,208,294 (GRCm39) probably benign Het
Arrb1 G T 7: 99,247,708 (GRCm39) V346L probably benign Het
Atrnl1 T A 19: 57,661,573 (GRCm39) F518I probably benign Het
Bank1 T A 3: 135,799,127 (GRCm39) I405F probably damaging Het
Cacna1h A G 17: 25,607,602 (GRCm39) L905P probably damaging Het
Cc2d1a A G 8: 84,860,465 (GRCm39) Y826H probably benign Het
Cenpo A G 12: 4,266,643 (GRCm39) V155A probably benign Het
Cnmd A G 14: 79,898,863 (GRCm39) F63S probably damaging Het
Cnn3 G A 3: 121,248,600 (GRCm39) G72D probably damaging Het
Cox10 A G 11: 63,962,539 (GRCm39) S101P probably benign Het
Ctdsp1 T C 1: 74,433,806 (GRCm39) V129A probably damaging Het
Cyp2d34 A T 15: 82,502,807 (GRCm39) S140T probably benign Het
Dennd5a G A 7: 109,532,820 (GRCm39) H317Y possibly damaging Het
Dnaaf9 A G 2: 130,555,334 (GRCm39) F858S probably damaging Het
Eef2 C CN 10: 81,014,603 (GRCm39) probably null Het
Enox1 T A 14: 77,819,876 (GRCm39) D210E probably damaging Het
Fam171a1 A G 2: 3,198,464 (GRCm39) N190S probably damaging Het
Fat2 T A 11: 55,144,459 (GRCm39) K4138N possibly damaging Het
Fat4 A T 3: 39,011,623 (GRCm39) D2241V probably damaging Het
Fbn1 C T 2: 125,245,090 (GRCm39) V266I possibly damaging Het
Fras1 T A 5: 96,900,857 (GRCm39) S3025R probably benign Het
Gba1 T C 3: 89,111,307 (GRCm39) I24T probably benign Het
Gdpd5 A G 7: 99,087,540 (GRCm39) D68G probably damaging Het
Grid1 G A 14: 34,544,576 (GRCm39) S49N probably benign Het
Grtp1 T C 8: 13,229,639 (GRCm39) T250A possibly damaging Het
Gucy1b1 T C 3: 81,945,295 (GRCm39) N448D probably benign Het
Ippk C A 13: 49,596,947 (GRCm39) Q254K probably damaging Het
Itga2 A T 13: 115,007,150 (GRCm39) L393I possibly damaging Het
Kcna10 A T 3: 107,102,575 (GRCm39) E402V possibly damaging Het
Kcnab1 G A 3: 65,205,141 (GRCm39) D119N probably damaging Het
Kcnip4 T A 5: 48,567,202 (GRCm39) T122S probably benign Het
Kcnma1 G A 14: 23,350,086 (GRCm39) P1151L probably damaging Het
Klhl22 T A 16: 17,610,453 (GRCm39) M568K probably benign Het
Krt6a C T 15: 101,601,183 (GRCm39) V257M probably damaging Het
Ksr2 A C 5: 117,693,290 (GRCm39) H246P probably damaging Het
Lca5 T C 9: 83,281,806 (GRCm39) D326G possibly damaging Het
Lcp1 A G 14: 75,451,928 (GRCm39) E393G probably benign Het
Leo1 G A 9: 75,352,831 (GRCm39) E125K probably benign Het
Lipt1 T A 1: 37,914,382 (GRCm39) V146E probably damaging Het
Mael A T 1: 166,062,968 (GRCm39) probably null Het
Mga C T 2: 119,778,442 (GRCm39) L1996F probably damaging Het
Mllt6 A G 11: 97,569,387 (GRCm39) N913S probably damaging Het
Mphosph9 A C 5: 124,436,822 (GRCm39) D507E probably damaging Het
Mvp G A 7: 126,586,728 (GRCm39) A801V probably benign Het
Neb T C 2: 52,182,707 (GRCm39) D1053G possibly damaging Het
Nubp1 C A 16: 10,231,585 (GRCm39) L79I probably benign Het
Or1e1f G A 11: 73,856,246 (GRCm39) E271K probably benign Het
Or1o2 A C 17: 37,543,223 (GRCm39) L13V probably benign Het
Or8d2 G A 9: 38,759,805 (GRCm39) V132I probably benign Het
Pithd1 A G 4: 135,704,445 (GRCm39) probably benign Het
Pnpla8 G A 12: 44,330,188 (GRCm39) V29M probably benign Het
Psmb2 T A 4: 126,601,350 (GRCm39) I151N possibly damaging Het
Ptgs2 C T 1: 149,977,105 (GRCm39) T104I probably benign Het
Ptpro A G 6: 137,345,077 (GRCm39) T28A probably benign Het
Raf1 A G 6: 115,603,671 (GRCm39) probably null Het
Ranbp2 T C 10: 58,301,351 (GRCm39) M668T probably benign Het
Rbm48 A T 5: 3,641,760 (GRCm39) probably null Het
Rhag A T 17: 41,142,469 (GRCm39) T225S possibly damaging Het
Rhof A C 5: 123,269,950 (GRCm39) L69R probably damaging Het
Slc22a1 T C 17: 12,885,505 (GRCm39) probably benign Het
Slc24a5 T C 2: 124,910,724 (GRCm39) S52P probably damaging Het
Slc8a2 T C 7: 15,875,039 (GRCm39) V429A probably damaging Het
Spam1 G A 6: 24,796,886 (GRCm39) R279H probably damaging Het
Spata16 T A 3: 26,967,487 (GRCm39) probably benign Het
Srfbp1 A G 18: 52,620,588 (GRCm39) D102G probably damaging Het
Srrm3 A C 5: 135,902,136 (GRCm39) probably benign Het
Tbl1xr1 T A 3: 22,254,751 (GRCm39) probably benign Het
Tk1 T C 11: 117,712,933 (GRCm39) E98G probably damaging Het
Trim13 G A 14: 61,843,149 (GRCm39) V389I probably benign Het
Ttc28 A T 5: 111,383,366 (GRCm39) Y1289F probably benign Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ugt1a10 T A 1: 87,983,904 (GRCm39) V234D probably benign Het
Vmn2r75 C T 7: 85,814,575 (GRCm39) G306E probably benign Het
Vmn2r86 C T 10: 130,289,497 (GRCm39) V133I probably benign Het
Vps13c C A 9: 67,841,758 (GRCm39) Q1927K probably benign Het
Zbtb14 C A 17: 69,695,497 (GRCm39) F398L probably damaging Het
Zfp219 T A 14: 52,244,395 (GRCm39) T550S probably benign Het
Zfp329 T A 7: 12,545,395 (GRCm39) N43I probably benign Het
Other mutations in Hmcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Hmcn2 APN 2 31,233,108 (GRCm39) missense probably damaging 1.00
IGL00966:Hmcn2 APN 2 31,319,006 (GRCm39) missense probably damaging 0.97
IGL00973:Hmcn2 APN 2 31,273,833 (GRCm39) intron probably benign
IGL01364:Hmcn2 APN 2 31,251,826 (GRCm39) nonsense probably null
IGL01486:Hmcn2 APN 2 31,226,633 (GRCm39) missense probably damaging 1.00
IGL01530:Hmcn2 APN 2 31,244,276 (GRCm39) missense possibly damaging 0.85
IGL01550:Hmcn2 APN 2 31,314,264 (GRCm39) missense possibly damaging 0.84
IGL01710:Hmcn2 APN 2 31,233,114 (GRCm39) missense probably damaging 1.00
IGL01764:Hmcn2 APN 2 31,295,642 (GRCm39) missense possibly damaging 0.93
IGL01924:Hmcn2 APN 2 31,288,929 (GRCm39) missense probably benign 0.00
IGL02003:Hmcn2 APN 2 31,318,994 (GRCm39) missense possibly damaging 0.90
IGL02117:Hmcn2 APN 2 31,347,185 (GRCm39) missense possibly damaging 0.75
IGL02205:Hmcn2 APN 2 31,290,139 (GRCm39) missense probably damaging 1.00
IGL02273:Hmcn2 APN 2 31,314,389 (GRCm39) missense probably benign 0.06
IGL02313:Hmcn2 APN 2 31,343,617 (GRCm39) missense possibly damaging 0.68
IGL02326:Hmcn2 APN 2 31,340,964 (GRCm39) missense probably damaging 0.97
IGL02486:Hmcn2 APN 2 31,310,107 (GRCm39) missense probably damaging 0.98
IGL02551:Hmcn2 APN 2 31,344,823 (GRCm39) missense possibly damaging 0.83
IGL02695:Hmcn2 APN 2 31,298,985 (GRCm39) missense possibly damaging 0.87
IGL02725:Hmcn2 APN 2 31,295,540 (GRCm39) missense probably damaging 1.00
IGL02792:Hmcn2 APN 2 31,236,602 (GRCm39) missense probably damaging 1.00
IGL02882:Hmcn2 APN 2 31,303,379 (GRCm39) nonsense probably null
IGL03003:Hmcn2 APN 2 31,323,498 (GRCm39) missense probably damaging 0.98
IGL03067:Hmcn2 APN 2 31,236,642 (GRCm39) missense probably damaging 1.00
IGL03137:Hmcn2 APN 2 31,252,242 (GRCm39) missense probably damaging 0.98
IGL03220:Hmcn2 APN 2 31,236,633 (GRCm39) missense possibly damaging 0.94
IGL03411:Hmcn2 APN 2 31,236,649 (GRCm39) missense possibly damaging 0.83
PIT4544001:Hmcn2 UTSW 2 31,318,262 (GRCm39) missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31,302,520 (GRCm39) missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31,302,520 (GRCm39) missense probably damaging 0.98
R0048:Hmcn2 UTSW 2 31,318,249 (GRCm39) missense possibly damaging 0.92
R0048:Hmcn2 UTSW 2 31,318,249 (GRCm39) missense possibly damaging 0.92
R0078:Hmcn2 UTSW 2 31,278,356 (GRCm39) missense probably damaging 1.00
R0090:Hmcn2 UTSW 2 31,316,210 (GRCm39) missense probably damaging 1.00
R0173:Hmcn2 UTSW 2 31,328,343 (GRCm39) critical splice donor site probably null
R0257:Hmcn2 UTSW 2 31,259,176 (GRCm39) splice site probably benign
R0266:Hmcn2 UTSW 2 31,335,365 (GRCm39) splice site probably benign
R0266:Hmcn2 UTSW 2 31,284,839 (GRCm39) missense probably benign 0.03
R0326:Hmcn2 UTSW 2 31,313,237 (GRCm39) nonsense probably null
R0366:Hmcn2 UTSW 2 31,314,218 (GRCm39) missense possibly damaging 0.88
R0400:Hmcn2 UTSW 2 31,290,141 (GRCm39) missense probably damaging 0.98
R0412:Hmcn2 UTSW 2 31,278,259 (GRCm39) missense probably damaging 0.98
R0436:Hmcn2 UTSW 2 31,295,624 (GRCm39) missense probably damaging 1.00
R0457:Hmcn2 UTSW 2 31,305,296 (GRCm39) critical splice donor site probably null
R0487:Hmcn2 UTSW 2 31,276,689 (GRCm39) missense possibly damaging 0.60
R0568:Hmcn2 UTSW 2 31,305,248 (GRCm39) missense probably benign 0.02
R0755:Hmcn2 UTSW 2 31,343,172 (GRCm39) missense probably damaging 0.99
R0812:Hmcn2 UTSW 2 31,310,383 (GRCm39) missense probably damaging 0.99
R0964:Hmcn2 UTSW 2 31,281,523 (GRCm39) missense probably benign 0.23
R0988:Hmcn2 UTSW 2 31,225,463 (GRCm39) missense probably damaging 1.00
R1484:Hmcn2 UTSW 2 31,236,507 (GRCm39) missense probably damaging 1.00
R1509:Hmcn2 UTSW 2 31,204,491 (GRCm39) missense possibly damaging 0.86
R1535:Hmcn2 UTSW 2 31,310,419 (GRCm39) missense possibly damaging 0.91
R1574:Hmcn2 UTSW 2 31,294,899 (GRCm39) missense probably damaging 0.97
R1574:Hmcn2 UTSW 2 31,294,899 (GRCm39) missense probably damaging 0.97
R1600:Hmcn2 UTSW 2 31,320,799 (GRCm39) missense probably damaging 0.98
R1623:Hmcn2 UTSW 2 31,348,051 (GRCm39) missense possibly damaging 0.84
R1692:Hmcn2 UTSW 2 31,340,856 (GRCm39) missense possibly damaging 0.47
R1719:Hmcn2 UTSW 2 31,244,733 (GRCm39) missense probably damaging 1.00
R1747:Hmcn2 UTSW 2 31,347,997 (GRCm39) missense probably benign 0.00
R1756:Hmcn2 UTSW 2 31,286,132 (GRCm39) missense probably damaging 0.99
R1763:Hmcn2 UTSW 2 31,204,602 (GRCm39) missense probably damaging 1.00
R1815:Hmcn2 UTSW 2 31,283,055 (GRCm39) missense probably damaging 0.97
R1822:Hmcn2 UTSW 2 31,273,704 (GRCm39) missense probably damaging 0.99
R1858:Hmcn2 UTSW 2 31,305,295 (GRCm39) critical splice donor site probably null
R1895:Hmcn2 UTSW 2 31,295,647 (GRCm39) missense probably damaging 0.99
R1908:Hmcn2 UTSW 2 31,301,922 (GRCm39) critical splice donor site probably null
R1946:Hmcn2 UTSW 2 31,295,647 (GRCm39) missense probably damaging 0.99
R1966:Hmcn2 UTSW 2 31,279,341 (GRCm39) missense probably damaging 0.99
R2007:Hmcn2 UTSW 2 31,328,267 (GRCm39) missense possibly damaging 0.91
R2050:Hmcn2 UTSW 2 31,225,448 (GRCm39) missense probably damaging 1.00
R2055:Hmcn2 UTSW 2 31,268,294 (GRCm39) missense probably benign 0.33
R2097:Hmcn2 UTSW 2 31,270,431 (GRCm39) missense probably damaging 1.00
R2145:Hmcn2 UTSW 2 31,223,943 (GRCm39) splice site probably benign
R2155:Hmcn2 UTSW 2 31,350,361 (GRCm39) missense possibly damaging 0.68
R2170:Hmcn2 UTSW 2 31,270,293 (GRCm39) missense probably benign 0.08
R2188:Hmcn2 UTSW 2 31,309,947 (GRCm39) missense probably benign 0.14
R2208:Hmcn2 UTSW 2 31,270,309 (GRCm39) missense probably damaging 1.00
R2217:Hmcn2 UTSW 2 31,240,586 (GRCm39) missense probably benign 0.02
R2407:Hmcn2 UTSW 2 31,225,424 (GRCm39) critical splice acceptor site probably null
R2764:Hmcn2 UTSW 2 31,278,310 (GRCm39) missense probably damaging 0.98
R2913:Hmcn2 UTSW 2 31,350,222 (GRCm39) missense possibly damaging 0.68
R2986:Hmcn2 UTSW 2 31,251,010 (GRCm39) missense probably damaging 1.00
R3157:Hmcn2 UTSW 2 31,290,267 (GRCm39) missense probably damaging 0.99
R3406:Hmcn2 UTSW 2 31,323,284 (GRCm39) splice site probably benign
R3429:Hmcn2 UTSW 2 31,299,156 (GRCm39) missense possibly damaging 0.87
R3737:Hmcn2 UTSW 2 31,226,624 (GRCm39) nonsense probably null
R3739:Hmcn2 UTSW 2 31,226,624 (GRCm39) nonsense probably null
R3771:Hmcn2 UTSW 2 31,250,908 (GRCm39) missense probably damaging 0.99
R3772:Hmcn2 UTSW 2 31,250,908 (GRCm39) missense probably damaging 0.99
R3773:Hmcn2 UTSW 2 31,250,908 (GRCm39) missense probably damaging 0.99
R3804:Hmcn2 UTSW 2 31,242,897 (GRCm39) splice site probably null
R3837:Hmcn2 UTSW 2 31,303,419 (GRCm39) missense probably damaging 0.99
R3838:Hmcn2 UTSW 2 31,303,419 (GRCm39) missense probably damaging 0.99
R3846:Hmcn2 UTSW 2 31,320,362 (GRCm39) missense possibly damaging 0.51
R3925:Hmcn2 UTSW 2 31,343,169 (GRCm39) missense probably benign 0.00
R3934:Hmcn2 UTSW 2 31,270,496 (GRCm39) critical splice donor site probably null
R3946:Hmcn2 UTSW 2 31,272,406 (GRCm39) missense possibly damaging 0.91
R4035:Hmcn2 UTSW 2 31,226,624 (GRCm39) nonsense probably null
R4057:Hmcn2 UTSW 2 31,290,250 (GRCm39) missense probably damaging 1.00
R4583:Hmcn2 UTSW 2 31,303,277 (GRCm39) missense possibly damaging 0.84
R4623:Hmcn2 UTSW 2 31,286,722 (GRCm39) missense probably damaging 1.00
R4647:Hmcn2 UTSW 2 31,289,031 (GRCm39) missense possibly damaging 0.82
R4668:Hmcn2 UTSW 2 31,325,804 (GRCm39) missense probably benign 0.40
R4669:Hmcn2 UTSW 2 31,325,804 (GRCm39) missense probably benign 0.40
R4687:Hmcn2 UTSW 2 31,328,297 (GRCm39) missense probably benign 0.14
R4735:Hmcn2 UTSW 2 31,273,787 (GRCm39) missense probably benign 0.06
R4772:Hmcn2 UTSW 2 31,335,326 (GRCm39) missense probably benign 0.02
R4866:Hmcn2 UTSW 2 31,279,403 (GRCm39) missense possibly damaging 0.88
R4916:Hmcn2 UTSW 2 31,250,992 (GRCm39) missense probably damaging 0.98
R4943:Hmcn2 UTSW 2 31,225,504 (GRCm39) missense probably damaging 1.00
R4967:Hmcn2 UTSW 2 31,244,176 (GRCm39) critical splice acceptor site probably null
R4973:Hmcn2 UTSW 2 31,234,108 (GRCm39) missense probably benign 0.15
R4975:Hmcn2 UTSW 2 31,283,037 (GRCm39) missense possibly damaging 0.88
R4994:Hmcn2 UTSW 2 31,348,067 (GRCm39) critical splice donor site probably null
R4997:Hmcn2 UTSW 2 31,291,720 (GRCm39) missense probably damaging 1.00
R5045:Hmcn2 UTSW 2 31,299,093 (GRCm39) missense probably damaging 1.00
R5117:Hmcn2 UTSW 2 31,348,061 (GRCm39) missense possibly damaging 0.95
R5151:Hmcn2 UTSW 2 31,279,455 (GRCm39) missense probably null
R5232:Hmcn2 UTSW 2 31,347,760 (GRCm39) missense probably damaging 0.99
R5237:Hmcn2 UTSW 2 31,304,728 (GRCm39) missense probably benign 0.01
R5288:Hmcn2 UTSW 2 31,350,333 (GRCm39) missense probably benign 0.11
R5375:Hmcn2 UTSW 2 31,320,453 (GRCm39) missense possibly damaging 0.92
R5379:Hmcn2 UTSW 2 31,299,023 (GRCm39) missense probably damaging 0.99
R5385:Hmcn2 UTSW 2 31,350,333 (GRCm39) missense probably benign 0.11
R5412:Hmcn2 UTSW 2 31,236,629 (GRCm39) missense possibly damaging 0.77
R5426:Hmcn2 UTSW 2 31,226,556 (GRCm39) missense possibly damaging 0.95
R5434:Hmcn2 UTSW 2 31,310,375 (GRCm39) missense probably damaging 1.00
R5441:Hmcn2 UTSW 2 31,296,428 (GRCm39) missense possibly damaging 0.82
R5484:Hmcn2 UTSW 2 31,283,066 (GRCm39) nonsense probably null
R5492:Hmcn2 UTSW 2 31,310,318 (GRCm39) missense probably benign 0.03
R5572:Hmcn2 UTSW 2 31,304,538 (GRCm39) critical splice acceptor site probably null
R5572:Hmcn2 UTSW 2 31,304,537 (GRCm39) critical splice acceptor site probably null
R5591:Hmcn2 UTSW 2 31,234,059 (GRCm39) missense probably damaging 1.00
R5614:Hmcn2 UTSW 2 31,318,315 (GRCm39) missense probably damaging 0.99
R5634:Hmcn2 UTSW 2 31,223,893 (GRCm39) missense probably damaging 1.00
R5645:Hmcn2 UTSW 2 31,310,824 (GRCm39) missense possibly damaging 0.92
R5716:Hmcn2 UTSW 2 31,348,750 (GRCm39) missense possibly damaging 0.68
R5716:Hmcn2 UTSW 2 31,226,579 (GRCm39) missense probably damaging 1.00
R5725:Hmcn2 UTSW 2 31,273,827 (GRCm39) critical splice donor site probably null
R5760:Hmcn2 UTSW 2 31,304,580 (GRCm39) missense possibly damaging 0.91
R5774:Hmcn2 UTSW 2 31,299,147 (GRCm39) missense possibly damaging 0.94
R5838:Hmcn2 UTSW 2 31,347,819 (GRCm39) missense probably damaging 0.99
R5899:Hmcn2 UTSW 2 31,244,685 (GRCm39) missense possibly damaging 0.93
R5916:Hmcn2 UTSW 2 31,286,151 (GRCm39) missense probably damaging 1.00
R5973:Hmcn2 UTSW 2 31,310,335 (GRCm39) missense probably damaging 0.99
R6002:Hmcn2 UTSW 2 31,310,321 (GRCm39) missense probably damaging 0.99
R6018:Hmcn2 UTSW 2 31,260,804 (GRCm39) missense probably benign 0.13
R6063:Hmcn2 UTSW 2 31,324,725 (GRCm39) missense probably benign 0.06
R6161:Hmcn2 UTSW 2 31,246,266 (GRCm39) missense probably benign
R6166:Hmcn2 UTSW 2 31,259,274 (GRCm39) missense probably damaging 1.00
R6177:Hmcn2 UTSW 2 31,310,118 (GRCm39) nonsense probably null
R6191:Hmcn2 UTSW 2 31,348,758 (GRCm39) missense probably damaging 0.99
R6195:Hmcn2 UTSW 2 31,274,127 (GRCm39) missense probably damaging 0.96
R6273:Hmcn2 UTSW 2 31,301,846 (GRCm39) missense probably damaging 0.99
R6293:Hmcn2 UTSW 2 31,225,463 (GRCm39) missense probably damaging 1.00
R6349:Hmcn2 UTSW 2 31,278,385 (GRCm39) missense probably damaging 1.00
R6395:Hmcn2 UTSW 2 31,259,269 (GRCm39) missense probably damaging 1.00
R6448:Hmcn2 UTSW 2 31,310,832 (GRCm39) missense probably benign 0.02
R6450:Hmcn2 UTSW 2 31,251,812 (GRCm39) missense probably benign 0.11
R6479:Hmcn2 UTSW 2 31,315,480 (GRCm39) missense probably damaging 0.99
R6502:Hmcn2 UTSW 2 31,272,490 (GRCm39) missense probably damaging 0.99
R6511:Hmcn2 UTSW 2 31,246,354 (GRCm39) missense possibly damaging 0.79
R6537:Hmcn2 UTSW 2 31,305,280 (GRCm39) missense probably benign 0.00
R6880:Hmcn2 UTSW 2 31,233,068 (GRCm39) missense probably damaging 1.00
R6924:Hmcn2 UTSW 2 31,240,517 (GRCm39) splice site probably null
R6971:Hmcn2 UTSW 2 31,322,333 (GRCm39) missense probably benign 0.02
R7057:Hmcn2 UTSW 2 31,312,661 (GRCm39) missense probably damaging 0.99
R7141:Hmcn2 UTSW 2 31,250,908 (GRCm39) missense probably benign 0.17
R7268:Hmcn2 UTSW 2 31,347,978 (GRCm39) missense possibly damaging 0.48
R7307:Hmcn2 UTSW 2 31,233,093 (GRCm39) missense probably damaging 0.96
R7322:Hmcn2 UTSW 2 31,349,093 (GRCm39) missense probably damaging 0.99
R7334:Hmcn2 UTSW 2 31,343,147 (GRCm39) missense possibly damaging 0.82
R7334:Hmcn2 UTSW 2 31,325,806 (GRCm39) missense probably damaging 0.98
R7335:Hmcn2 UTSW 2 31,282,169 (GRCm39) missense possibly damaging 0.88
R7358:Hmcn2 UTSW 2 31,306,824 (GRCm39) missense probably damaging 1.00
R7359:Hmcn2 UTSW 2 31,278,395 (GRCm39) missense probably benign 0.13
R7488:Hmcn2 UTSW 2 31,310,842 (GRCm39) missense probably damaging 1.00
R7498:Hmcn2 UTSW 2 31,273,487 (GRCm39) splice site probably null
R7560:Hmcn2 UTSW 2 31,347,185 (GRCm39) missense probably benign
R7566:Hmcn2 UTSW 2 31,344,869 (GRCm39) missense probably damaging 0.96
R7570:Hmcn2 UTSW 2 31,313,923 (GRCm39) missense probably benign
R7574:Hmcn2 UTSW 2 31,345,531 (GRCm39) missense possibly damaging 0.68
R7599:Hmcn2 UTSW 2 31,246,298 (GRCm39) missense possibly damaging 0.93
R7654:Hmcn2 UTSW 2 31,236,581 (GRCm39) missense probably benign 0.00
R7662:Hmcn2 UTSW 2 31,272,357 (GRCm39) missense probably benign 0.01
R7666:Hmcn2 UTSW 2 31,270,245 (GRCm39) missense probably damaging 1.00
R7698:Hmcn2 UTSW 2 31,313,165 (GRCm39) missense probably damaging 0.98
R7722:Hmcn2 UTSW 2 31,272,512 (GRCm39) nonsense probably null
R7739:Hmcn2 UTSW 2 31,348,038 (GRCm39) missense possibly damaging 0.48
R7749:Hmcn2 UTSW 2 31,343,045 (GRCm39) splice site probably null
R7828:Hmcn2 UTSW 2 31,295,887 (GRCm39) missense possibly damaging 0.95
R7912:Hmcn2 UTSW 2 31,310,311 (GRCm39) missense probably benign 0.00
R7978:Hmcn2 UTSW 2 31,279,359 (GRCm39) missense probably benign 0.40
R8075:Hmcn2 UTSW 2 31,279,403 (GRCm39) missense possibly damaging 0.88
R8088:Hmcn2 UTSW 2 31,316,915 (GRCm39) nonsense probably null
R8101:Hmcn2 UTSW 2 31,240,082 (GRCm39) missense probably benign 0.08
R8124:Hmcn2 UTSW 2 31,290,136 (GRCm39) missense probably benign 0.01
R8145:Hmcn2 UTSW 2 31,313,117 (GRCm39) missense probably damaging 1.00
R8230:Hmcn2 UTSW 2 31,234,485 (GRCm39) missense possibly damaging 0.91
R8267:Hmcn2 UTSW 2 31,349,191 (GRCm39) missense probably benign
R8277:Hmcn2 UTSW 2 31,259,189 (GRCm39) missense probably benign 0.16
R8307:Hmcn2 UTSW 2 31,286,127 (GRCm39) missense probably damaging 0.99
R8353:Hmcn2 UTSW 2 31,275,353 (GRCm39) splice site probably null
R8415:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8416:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8437:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8438:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8440:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8442:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8497:Hmcn2 UTSW 2 31,313,357 (GRCm39) missense possibly damaging 0.92
R8520:Hmcn2 UTSW 2 31,244,726 (GRCm39) missense probably damaging 1.00
R8530:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8537:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8550:Hmcn2 UTSW 2 31,240,654 (GRCm39) critical splice donor site probably null
R8721:Hmcn2 UTSW 2 31,315,189 (GRCm39) missense probably damaging 1.00
R8795:Hmcn2 UTSW 2 31,315,393 (GRCm39) missense probably benign 0.01
R8802:Hmcn2 UTSW 2 31,301,288 (GRCm39) missense probably damaging 0.97
R8804:Hmcn2 UTSW 2 31,315,393 (GRCm39) missense probably benign 0.01
R8805:Hmcn2 UTSW 2 31,315,393 (GRCm39) missense probably benign 0.01
R8904:Hmcn2 UTSW 2 31,323,404 (GRCm39) missense possibly damaging 0.92
R8937:Hmcn2 UTSW 2 31,204,427 (GRCm39) start codon destroyed probably benign 0.01
R8947:Hmcn2 UTSW 2 31,278,220 (GRCm39) missense probably damaging 0.99
R8948:Hmcn2 UTSW 2 31,244,741 (GRCm39) missense probably damaging 1.00
R8950:Hmcn2 UTSW 2 31,244,741 (GRCm39) missense probably damaging 1.00
R8959:Hmcn2 UTSW 2 31,282,159 (GRCm39) missense probably damaging 1.00
R9025:Hmcn2 UTSW 2 31,347,967 (GRCm39) missense possibly damaging 0.56
R9039:Hmcn2 UTSW 2 31,244,646 (GRCm39) missense probably damaging 0.97
R9068:Hmcn2 UTSW 2 31,303,685 (GRCm39) missense probably benign 0.01
R9161:Hmcn2 UTSW 2 31,242,758 (GRCm39) missense probably benign 0.02
R9178:Hmcn2 UTSW 2 31,281,521 (GRCm39) missense possibly damaging 0.77
R9204:Hmcn2 UTSW 2 31,278,377 (GRCm39) missense probably damaging 0.98
R9317:Hmcn2 UTSW 2 31,350,328 (GRCm39) missense possibly damaging 0.91
R9341:Hmcn2 UTSW 2 31,279,359 (GRCm39) missense probably benign 0.40
R9343:Hmcn2 UTSW 2 31,279,359 (GRCm39) missense probably benign 0.40
R9355:Hmcn2 UTSW 2 31,328,302 (GRCm39) missense probably benign 0.18
R9371:Hmcn2 UTSW 2 31,301,917 (GRCm39) missense probably damaging 1.00
R9450:Hmcn2 UTSW 2 31,316,845 (GRCm39) missense probably damaging 1.00
R9477:Hmcn2 UTSW 2 31,286,031 (GRCm39) critical splice acceptor site probably null
R9483:Hmcn2 UTSW 2 31,320,375 (GRCm39) missense
R9536:Hmcn2 UTSW 2 31,335,130 (GRCm39) missense possibly damaging 0.86
R9580:Hmcn2 UTSW 2 31,294,875 (GRCm39) missense probably benign 0.16
R9593:Hmcn2 UTSW 2 31,244,742 (GRCm39) missense probably damaging 0.99
R9649:Hmcn2 UTSW 2 31,292,450 (GRCm39) missense possibly damaging 0.95
R9706:Hmcn2 UTSW 2 31,305,279 (GRCm39) missense probably benign 0.00
X0066:Hmcn2 UTSW 2 31,344,823 (GRCm39) missense possibly damaging 0.83
X0067:Hmcn2 UTSW 2 31,295,879 (GRCm39) missense possibly damaging 0.82
Z1088:Hmcn2 UTSW 2 31,349,076 (GRCm39) splice site probably null
Z1088:Hmcn2 UTSW 2 31,271,079 (GRCm39) missense probably benign 0.01
Z1176:Hmcn2 UTSW 2 31,319,103 (GRCm39) missense probably damaging 0.97
Z1176:Hmcn2 UTSW 2 31,315,428 (GRCm39) missense probably damaging 1.00
Z1176:Hmcn2 UTSW 2 31,234,041 (GRCm39) missense possibly damaging 0.95
Z1177:Hmcn2 UTSW 2 31,316,836 (GRCm39) missense probably damaging 0.99
Z1177:Hmcn2 UTSW 2 31,234,518 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACACTTGTGTGGCTGAGAACG -3'
(R):5'- GCTGTCATCAGGTCTTGACTGGAG -3'

Sequencing Primer
(F):5'- CCCGCAAAGACTTTGTAGTG -3'
(R):5'- CTTGACTGGAGGTTCCTGACTC -3'
Posted On 2013-10-16