Mutagenetix > Incidental Mutation

Incidental Mutation 'R0811:Ugcg'

78514

Institutional Source

Beutler Lab

Gene Symbol

Ugcg

Ensembl Gene

ENSMUSG00000028381

Gene Name

UDP-glucose ceramide glucosyltransferase

Synonyms

Epcs21, Ugcgl, GlcT-1

MMRRC Submission

038991-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0811 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59189257-59222833 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 59207798 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 46 (P46S)

Ref Sequence

ENSEMBL: ENSMUSP00000030074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030074]

AlphaFold

O88693

Predicted Effect

probably benign
Transcript: ENSMUST00000030074
AA Change: P46S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: P46S

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	51	278	1.3e-26	PFAM
Pfam:Glyco_transf_21	106	278	8.4e-61	PFAM
Pfam:Glyco_trans_2_3	139	368	9.6e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155153

Meta Mutation Damage Score

0.0799

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.3%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	G	2: 130,713,414	F858S	probably damaging	Het
Abcb1a	T	C	5: 8,713,229	S586P	probably damaging	Het
Ap5z1	G	A	5: 142,475,791	R583H	probably benign	Het
Arhgap28	TCAGCAGCAGCAGCAGCAGCAG	TCAGCAGCAGCAGCAGCAG	17: 67,901,299		probably benign	Het
Arrb1	G	T	7: 99,598,501	V346L	probably benign	Het
Atrnl1	T	A	19: 57,673,141	F518I	probably benign	Het
Bank1	T	A	3: 136,093,366	I405F	probably damaging	Het
Cacna1h	A	G	17: 25,388,628	L905P	probably damaging	Het
Cc2d1a	A	G	8: 84,133,836	Y826H	probably benign	Het
Cenpo	A	G	12: 4,216,643	V155A	probably benign	Het
Cnmd	A	G	14: 79,661,423	F63S	probably damaging	Het
Cnn3	G	A	3: 121,454,951	G72D	probably damaging	Het
Cox10	A	G	11: 64,071,713	S101P	probably benign	Het
Ctdsp1	T	C	1: 74,394,647	V129A	probably damaging	Het
Cyp2d34	A	T	15: 82,618,606	S140T	probably benign	Het
Dennd5a	G	A	7: 109,933,613	H317Y	possibly damaging	Het
Eef2	C	CN	10: 81,178,769		probably null	Het
Enox1	T	A	14: 77,582,436	D210E	probably damaging	Het
Fam171a1	A	G	2: 3,197,427	N190S	probably damaging	Het
Fat2	T	A	11: 55,253,633	K4138N	possibly damaging	Het
Fat4	A	T	3: 38,957,474	D2241V	probably damaging	Het
Fbn1	C	T	2: 125,403,170	V266I	possibly damaging	Het
Fras1	T	A	5: 96,752,998	S3025R	probably benign	Het
Gba	T	C	3: 89,204,000	I24T	probably benign	Het
Gdpd5	A	G	7: 99,438,333	D68G	probably damaging	Het
Grid1	G	A	14: 34,822,619	S49N	probably benign	Het
Grtp1	T	C	8: 13,179,639	T250A	possibly damaging	Het
Gucy1b1	T	C	3: 82,037,988	N448D	probably benign	Het
Hmcn2	G	A	2: 31,420,371	A3326T	probably damaging	Het
Ippk	C	A	13: 49,443,471	Q254K	probably damaging	Het
Itga2	A	T	13: 114,870,614	L393I	possibly damaging	Het
Kcna10	A	T	3: 107,195,259	E402V	possibly damaging	Het
Kcnab1	G	A	3: 65,297,720	D119N	probably damaging	Het
Kcnip4	T	A	5: 48,409,860	T122S	probably benign	Het
Kcnma1	G	A	14: 23,300,018	P1151L	probably damaging	Het
Klhl22	T	A	16: 17,792,589	M568K	probably benign	Het
Krt6a	C	T	15: 101,692,748	V257M	probably damaging	Het
Ksr2	A	C	5: 117,555,225	H246P	probably damaging	Het
Lca5	T	C	9: 83,399,753	D326G	possibly damaging	Het
Lcp1	A	G	14: 75,214,488	E393G	probably benign	Het
Leo1	G	A	9: 75,445,549	E125K	probably benign	Het
Lipt1	T	A	1: 37,875,301	V146E	probably damaging	Het
Mael	A	T	1: 166,235,399		probably null	Het
Mga	C	T	2: 119,947,961	L1996F	probably damaging	Het
Mllt6	A	G	11: 97,678,561	N913S	probably damaging	Het
Mphosph9	A	C	5: 124,298,759	D507E	probably damaging	Het
Mvp	G	A	7: 126,987,556	A801V	probably benign	Het
Neb	T	C	2: 52,292,695	D1053G	possibly damaging	Het
Nubp1	C	A	16: 10,413,721	L79I	probably benign	Het
Olfr397	G	A	11: 73,965,420	E271K	probably benign	Het
Olfr924	G	A	9: 38,848,509	V132I	probably benign	Het
Olfr97	A	C	17: 37,232,332	L13V	probably benign	Het
Pithd1	A	G	4: 135,977,134		probably benign	Het
Pnpla8	G	A	12: 44,283,405	V29M	probably benign	Het
Psmb2	T	A	4: 126,707,557	I151N	possibly damaging	Het
Ptgs2	C	T	1: 150,101,354	T104I	probably benign	Het
Ptpro	A	G	6: 137,368,079	T28A	probably benign	Het
Raf1	A	G	6: 115,626,710		probably null	Het
Ranbp2	T	C	10: 58,465,529	M668T	probably benign	Het
Rbm48	A	T	5: 3,591,760		probably null	Het
Rhag	A	T	17: 40,831,578	T225S	possibly damaging	Het
Rhof	A	C	5: 123,131,887	L69R	probably damaging	Het
Slc22a1	T	C	17: 12,666,618		probably benign	Het
Slc24a5	T	C	2: 125,068,804	S52P	probably damaging	Het
Slc8a2	T	C	7: 16,141,114	V429A	probably damaging	Het
Spam1	G	A	6: 24,796,887	R279H	probably damaging	Het
Spata16	T	A	3: 26,913,338		probably benign	Het
Srfbp1	A	G	18: 52,487,516	D102G	probably damaging	Het
Srrm3	A	C	5: 135,873,282		probably benign	Het
Tbl1xr1	T	A	3: 22,200,587		probably benign	Het
Tk1	T	C	11: 117,822,107	E98G	probably damaging	Het
Trim13	G	A	14: 61,605,700	V389I	probably benign	Het
Ttc28	A	T	5: 111,235,500	Y1289F	probably benign	Het
Ugt1a10	T	A	1: 88,056,182	V234D	probably benign	Het
Vmn2r75	C	T	7: 86,165,367	G306E	probably benign	Het
Vmn2r86	C	T	10: 130,453,628	V133I	probably benign	Het
Vps13c	C	A	9: 67,934,476	Q1927K	probably benign	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp219	T	A	14: 52,006,938	T550S	probably benign	Het
Zfp329	T	A	7: 12,811,468	N43I	probably benign	Het

Other mutations in Ugcg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01447:Ugcg	APN	4	59213865	missense	possibly damaging	0.94
IGL01768:Ugcg	APN	4	59217216	critical splice donor site	probably null
IGL02636:Ugcg	APN	4	59207763	missense	possibly damaging	0.73
IGL02672:Ugcg	APN	4	59218587	splice site	probably benign
IGL02798:Ugcg	APN	4	59220346	missense	probably damaging	1.00
congee	UTSW	4	59207798	missense	probably benign	0.17
cream_o_wheat	UTSW	4	59220387	missense	possibly damaging	0.91
gruel	UTSW	4	59189690	missense	probably benign
Porridge	UTSW	4	59219530	missense	possibly damaging	0.86
slop	UTSW	4	59211883	missense	probably benign	0.16
wheatina	UTSW	4	59220272	missense	probably damaging	0.96
PIT4382001:Ugcg	UTSW	4	59213246	missense	possibly damaging	0.68
R0013:Ugcg	UTSW	4	59213931	missense	possibly damaging	0.82
R0013:Ugcg	UTSW	4	59213931	missense	possibly damaging	0.82
R0068:Ugcg	UTSW	4	59217130	missense	probably benign	0.16
R0068:Ugcg	UTSW	4	59217130	missense	probably benign	0.16
R0119:Ugcg	UTSW	4	59217036	missense	possibly damaging	0.85
R0230:Ugcg	UTSW	4	59189739	nonsense	probably null
R0299:Ugcg	UTSW	4	59217036	missense	possibly damaging	0.85
R0384:Ugcg	UTSW	4	59220387	missense	possibly damaging	0.91
R0499:Ugcg	UTSW	4	59217036	missense	possibly damaging	0.85
R0645:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0688:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0726:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0802:Ugcg	UTSW	4	59189685	missense	probably benign	0.00
R0803:Ugcg	UTSW	4	59189685	missense	probably benign	0.00
R0812:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0828:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0831:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0944:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0945:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0947:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1104:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1209:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1210:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1252:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1253:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1255:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1488:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1490:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1548:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1698:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1771:Ugcg	UTSW	4	59207775	missense	probably benign	0.05
R1776:Ugcg	UTSW	4	59207775	missense	probably benign	0.05
R1781:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1794:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1840:Ugcg	UTSW	4	59219517	missense	probably damaging	1.00
R1942:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2228:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2229:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2237:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2239:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2314:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2337:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2338:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2340:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2422:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2426:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2433:Ugcg	UTSW	4	59207876	missense	possibly damaging	0.89
R2680:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3076:Ugcg	UTSW	4	59213922	missense	probably damaging	1.00
R3078:Ugcg	UTSW	4	59213922	missense	probably damaging	1.00
R3689:Ugcg	UTSW	4	59211883	missense	probably benign	0.16
R3732:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3732:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3733:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3766:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3767:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3768:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3769:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3771:Ugcg	UTSW	4	59189690	missense	probably benign
R3847:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3848:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3916:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3917:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3958:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3959:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4023:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4024:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4025:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4065:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4066:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4427:Ugcg	UTSW	4	59219555	missense	probably benign	0.02
R5842:Ugcg	UTSW	4	59219545	missense	possibly damaging	0.93
R6012:Ugcg	UTSW	4	59220272	missense	probably damaging	0.96
R6080:Ugcg	UTSW	4	59218524	missense	possibly damaging	0.70
R6762:Ugcg	UTSW	4	59219530	missense	possibly damaging	0.86
R7194:Ugcg	UTSW	4	59213210	missense	probably damaging	0.99
R7286:Ugcg	UTSW	4	59217111	missense	possibly damaging	0.95
R7362:Ugcg	UTSW	4	59217109	missense	probably damaging	1.00
R7472:Ugcg	UTSW	4	59217156	missense	probably benign
R7638:Ugcg	UTSW	4	59220299	missense	probably benign	0.26
R7866:Ugcg	UTSW	4	59211927	missense	possibly damaging	0.71
R8170:Ugcg	UTSW	4	59211974	missense	possibly damaging	0.71
R8488:Ugcg	UTSW	4	59213896	missense	probably benign	0.00
R8793:Ugcg	UTSW	4	59207794	missense	probably benign	0.22
R9441:Ugcg	UTSW	4	59207843	missense	probably damaging	1.00
Y4336:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
Y4337:Ugcg	UTSW	4	59207798	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- TCTTGCTCCTGGTTCTTGTGTTT -3'
(R):5'- AGGCTAGGCTGTTTTCACAATCA -3'

Sequencing Primer
(F):5'- TCTAACCCAACTCTGTTCAG -3'
(R):5'- CACGTATTCTTTCATTCCCC -3'

Posted On

2013-10-16