Mutagenetix > Incidental Mutation

Incidental Mutation 'R0811:Kcnma1'

78531

Institutional Source

Beutler Lab

Gene Symbol

Kcnma1

Ensembl Gene

ENSMUSG00000063142

Gene Name

potassium large conductance calcium-activated channel, subfamily M, alpha member 1

Synonyms

mSlo1, MaxiK, Slo1, 5730414M22Rik, BK channel alpha subunit, BKCa, Slo

MMRRC Submission

038991-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.790) question?

Stock #

R0811 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23289431-24014491 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 23300018 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 1151 (P1151L)

Ref Sequence

ENSEMBL: ENSMUSP00000141069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065788] [ENSMUST00000074983] [ENSMUST00000112423] [ENSMUST00000145596] [ENSMUST00000172099] [ENSMUST00000177634] [ENSMUST00000179097] [ENSMUST00000179836] [ENSMUST00000188210] [ENSMUST00000188285] [ENSMUST00000188991] [ENSMUST00000190044] [ENSMUST00000190985] [ENSMUST00000223655] [ENSMUST00000225431] [ENSMUST00000224787] [ENSMUST00000224468] [ENSMUST00000225556] [ENSMUST00000225315] [ENSMUST00000224077] [ENSMUST00000225794] [ENSMUST00000223727]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000065788
AA Change: P1067L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000065293
Gene: ENSMUSG00000063142
AA Change: P1067L

Domain	Start	End	E-Value	Type
low complexity region	20	31	N/A	INTRINSIC
transmembrane domain	54	73	N/A	INTRINSIC
Pfam:Ion_trans	91	262	2.2e-18	PFAM
Pfam:Ion_trans_2	180	268	5.7e-16	PFAM
Pfam:TrkA_N	314	413	7.5e-7	PFAM
Pfam:BK_channel_a	411	509	6.4e-31	PFAM
low complexity region	835	843	N/A	INTRINSIC
low complexity region	891	902	N/A	INTRINSIC
low complexity region	1005	1031	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000074983

SMART Domains

Protein: ENSMUSP00000074511
Gene: ENSMUSG00000063142

Domain	Start	End	E-Value	Type
low complexity region	20	31	N/A	INTRINSIC
transmembrane domain	54	73	N/A	INTRINSIC
Pfam:Ion_trans	91	262	2.2e-18	PFAM
Pfam:Ion_trans_2	180	268	5.7e-16	PFAM
Pfam:TrkA_N	314	413	7.5e-7	PFAM
Pfam:BK_channel_a	411	509	6.4e-31	PFAM
low complexity region	894	902	N/A	INTRINSIC
low complexity region	950	961	N/A	INTRINSIC
low complexity region	1064	1090	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112423
AA Change: P1014L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000108042
Gene: ENSMUSG00000063142
AA Change: P1014L

Domain	Start	End	E-Value	Type
transmembrane domain	2	19	N/A	INTRINSIC
Pfam:Ion_trans	37	208	2.1e-18	PFAM
Pfam:Ion_trans_2	126	214	5.3e-16	PFAM
Pfam:TrkA_N	260	359	7e-7	PFAM
Pfam:BK_channel_a	357	455	6e-31	PFAM
low complexity region	781	789	N/A	INTRINSIC
low complexity region	837	848	N/A	INTRINSIC
low complexity region	951	977	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000145596

Predicted Effect

probably benign
Transcript: ENSMUST00000172099

SMART Domains

Protein: ENSMUSP00000132204
Gene: ENSMUSG00000063142

Domain	Start	End	E-Value	Type
low complexity region	20	31	N/A	INTRINSIC
transmembrane domain	54	73	N/A	INTRINSIC
Pfam:Ion_trans	91	262	2.2e-18	PFAM
Pfam:Ion_trans_2	180	268	5.7e-16	PFAM
Pfam:TrkA_N	314	413	7.6e-7	PFAM
Pfam:BK_channel_a	411	509	6.5e-31	PFAM
low complexity region	897	905	N/A	INTRINSIC
low complexity region	953	964	N/A	INTRINSIC
low complexity region	1067	1093	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177634
AA Change: P1094L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000136447
Gene: ENSMUSG00000063142
AA Change: P1094L

Domain	Start	End	E-Value	Type
low complexity region	20	31	N/A	INTRINSIC
Pfam:Ion_trans	53	272	4.9e-19	PFAM
Pfam:Ion_trans_2	180	267	1.2e-15	PFAM
Pfam:BK_channel_a	413	508	1.2e-35	PFAM
low complexity region	862	870	N/A	INTRINSIC
low complexity region	918	929	N/A	INTRINSIC
low complexity region	1032	1058	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179097
AA Change: P1091L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000136568
Gene: ENSMUSG00000063142
AA Change: P1091L

Domain	Start	End	E-Value	Type
low complexity region	20	31	N/A	INTRINSIC
transmembrane domain	54	73	N/A	INTRINSIC
Pfam:Ion_trans	91	262	4.6e-18	PFAM
Pfam:Ion_trans_2	180	268	1e-15	PFAM
Pfam:TrkA_N	314	413	1.1e-7	PFAM
Pfam:BK_channel_a	411	509	3.2e-31	PFAM
low complexity region	859	867	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	1029	1055	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179836

SMART Domains

Protein: ENSMUSP00000137141
Gene: ENSMUSG00000063142

Domain	Start	End	E-Value	Type
low complexity region	20	31	N/A	INTRINSIC
transmembrane domain	54	73	N/A	INTRINSIC
Pfam:Ion_trans	91	262	4.2e-18	PFAM
Pfam:Ion_trans_2	180	268	9.5e-16	PFAM
Pfam:BK_channel_a	389	457	2.4e-15	PFAM
low complexity region	838	846	N/A	INTRINSIC
low complexity region	894	905	N/A	INTRINSIC
low complexity region	1008	1034	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000188210
AA Change: P1151L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000141069
Gene: ENSMUSG00000063142
AA Change: P1151L

Domain	Start	End	E-Value	Type
low complexity region	4	23	N/A	INTRINSIC
transmembrane domain	86	108	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
transmembrane domain	179	198	N/A	INTRINSIC
Pfam:Ion_trans	216	387	1.3e-18	PFAM
Pfam:Ion_trans_2	305	393	5.2e-16	PFAM
Pfam:TrkA_N	439	538	7.8e-7	PFAM
Pfam:BK_channel_a	536	634	5e-31	PFAM
low complexity region	988	996	N/A	INTRINSIC
low complexity region	1044	1055	N/A	INTRINSIC
low complexity region	1158	1184	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188285

SMART Domains

Protein: ENSMUSP00000140275
Gene: ENSMUSG00000063142

Domain	Start	End	E-Value	Type
low complexity region	4	23	N/A	INTRINSIC
transmembrane domain	86	108	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
transmembrane domain	179	198	N/A	INTRINSIC
Pfam:Ion_trans	216	387	1.3e-18	PFAM
Pfam:Ion_trans_2	305	393	5.4e-16	PFAM
Pfam:TrkA_N	439	538	8e-7	PFAM
Pfam:BK_channel_a	536	634	5.2e-31	PFAM
low complexity region	1019	1027	N/A	INTRINSIC
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1189	1215	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188991

SMART Domains

Protein: ENSMUSP00000140751
Gene: ENSMUSG00000063142

Domain	Start	End	E-Value	Type
low complexity region	4	23	N/A	INTRINSIC
transmembrane domain	86	108	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
transmembrane domain	179	198	N/A	INTRINSIC
Pfam:Ion_trans	216	387	3.3e-18	PFAM
Pfam:Ion_trans_2	305	393	1.1e-15	PFAM
Pfam:TrkA_N	439	538	3.7e-7	PFAM
Pfam:BK_channel_a	536	634	3.4e-31	PFAM
low complexity region	1015	1023	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1185	1211	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190044

SMART Domains

Protein: ENSMUSP00000140033
Gene: ENSMUSG00000063142

Domain	Start	End	E-Value	Type
low complexity region	4	23	N/A	INTRINSIC
transmembrane domain	86	108	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
transmembrane domain	179	198	N/A	INTRINSIC
Pfam:Ion_trans	216	387	1.3e-18	PFAM
Pfam:Ion_trans_2	305	393	5.1e-16	PFAM
Pfam:TrkA_N	439	538	7.5e-7	PFAM
Pfam:BK_channel_a	536	634	4.9e-31	PFAM
low complexity region	957	965	N/A	INTRINSIC
low complexity region	1013	1024	N/A	INTRINSIC
low complexity region	1127	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190985

Predicted Effect

probably benign
Transcript: ENSMUST00000223655

Predicted Effect

probably benign
Transcript: ENSMUST00000225431
AA Change: P1124L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

Predicted Effect

probably benign
Transcript: ENSMUST00000224787
AA Change: P1074L

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

Predicted Effect

probably benign
Transcript: ENSMUST00000224468

Predicted Effect

probably benign
Transcript: ENSMUST00000225556

Predicted Effect

probably benign
Transcript: ENSMUST00000225315

Predicted Effect

probably benign
Transcript: ENSMUST00000224077

Predicted Effect

probably benign
Transcript: ENSMUST00000225794

Predicted Effect

probably benign
Transcript: ENSMUST00000223727

Meta Mutation Damage Score

0.1732

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.3%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to cerebellar ataxia, Purkinje cell dysfunction, uneven gait patterns, bladder hyperactivity, urinary incontinence, abnormal colonic K+ secretion, and hearing impairment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	G	2: 130,713,414	F858S	probably damaging	Het
Abcb1a	T	C	5: 8,713,229	S586P	probably damaging	Het
Ap5z1	G	A	5: 142,475,791	R583H	probably benign	Het
Arhgap28	TCAGCAGCAGCAGCAGCAGCAG	TCAGCAGCAGCAGCAGCAG	17: 67,901,299		probably benign	Het
Arrb1	G	T	7: 99,598,501	V346L	probably benign	Het
Atrnl1	T	A	19: 57,673,141	F518I	probably benign	Het
Bank1	T	A	3: 136,093,366	I405F	probably damaging	Het
Cacna1h	A	G	17: 25,388,628	L905P	probably damaging	Het
Cc2d1a	A	G	8: 84,133,836	Y826H	probably benign	Het
Cenpo	A	G	12: 4,216,643	V155A	probably benign	Het
Cnmd	A	G	14: 79,661,423	F63S	probably damaging	Het
Cnn3	G	A	3: 121,454,951	G72D	probably damaging	Het
Cox10	A	G	11: 64,071,713	S101P	probably benign	Het
Ctdsp1	T	C	1: 74,394,647	V129A	probably damaging	Het
Cyp2d34	A	T	15: 82,618,606	S140T	probably benign	Het
Dennd5a	G	A	7: 109,933,613	H317Y	possibly damaging	Het
Eef2	C	CN	10: 81,178,769		probably null	Het
Enox1	T	A	14: 77,582,436	D210E	probably damaging	Het
Fam171a1	A	G	2: 3,197,427	N190S	probably damaging	Het
Fat2	T	A	11: 55,253,633	K4138N	possibly damaging	Het
Fat4	A	T	3: 38,957,474	D2241V	probably damaging	Het
Fbn1	C	T	2: 125,403,170	V266I	possibly damaging	Het
Fras1	T	A	5: 96,752,998	S3025R	probably benign	Het
Gba	T	C	3: 89,204,000	I24T	probably benign	Het
Gdpd5	A	G	7: 99,438,333	D68G	probably damaging	Het
Grid1	G	A	14: 34,822,619	S49N	probably benign	Het
Grtp1	T	C	8: 13,179,639	T250A	possibly damaging	Het
Gucy1b1	T	C	3: 82,037,988	N448D	probably benign	Het
Hmcn2	G	A	2: 31,420,371	A3326T	probably damaging	Het
Ippk	C	A	13: 49,443,471	Q254K	probably damaging	Het
Itga2	A	T	13: 114,870,614	L393I	possibly damaging	Het
Kcna10	A	T	3: 107,195,259	E402V	possibly damaging	Het
Kcnab1	G	A	3: 65,297,720	D119N	probably damaging	Het
Kcnip4	T	A	5: 48,409,860	T122S	probably benign	Het
Klhl22	T	A	16: 17,792,589	M568K	probably benign	Het
Krt6a	C	T	15: 101,692,748	V257M	probably damaging	Het
Ksr2	A	C	5: 117,555,225	H246P	probably damaging	Het
Lca5	T	C	9: 83,399,753	D326G	possibly damaging	Het
Lcp1	A	G	14: 75,214,488	E393G	probably benign	Het
Leo1	G	A	9: 75,445,549	E125K	probably benign	Het
Lipt1	T	A	1: 37,875,301	V146E	probably damaging	Het
Mael	A	T	1: 166,235,399		probably null	Het
Mga	C	T	2: 119,947,961	L1996F	probably damaging	Het
Mllt6	A	G	11: 97,678,561	N913S	probably damaging	Het
Mphosph9	A	C	5: 124,298,759	D507E	probably damaging	Het
Mvp	G	A	7: 126,987,556	A801V	probably benign	Het
Neb	T	C	2: 52,292,695	D1053G	possibly damaging	Het
Nubp1	C	A	16: 10,413,721	L79I	probably benign	Het
Olfr397	G	A	11: 73,965,420	E271K	probably benign	Het
Olfr924	G	A	9: 38,848,509	V132I	probably benign	Het
Olfr97	A	C	17: 37,232,332	L13V	probably benign	Het
Pithd1	A	G	4: 135,977,134		probably benign	Het
Pnpla8	G	A	12: 44,283,405	V29M	probably benign	Het
Psmb2	T	A	4: 126,707,557	I151N	possibly damaging	Het
Ptgs2	C	T	1: 150,101,354	T104I	probably benign	Het
Ptpro	A	G	6: 137,368,079	T28A	probably benign	Het
Raf1	A	G	6: 115,626,710		probably null	Het
Ranbp2	T	C	10: 58,465,529	M668T	probably benign	Het
Rbm48	A	T	5: 3,591,760		probably null	Het
Rhag	A	T	17: 40,831,578	T225S	possibly damaging	Het
Rhof	A	C	5: 123,131,887	L69R	probably damaging	Het
Slc22a1	T	C	17: 12,666,618		probably benign	Het
Slc24a5	T	C	2: 125,068,804	S52P	probably damaging	Het
Slc8a2	T	C	7: 16,141,114	V429A	probably damaging	Het
Spam1	G	A	6: 24,796,887	R279H	probably damaging	Het
Spata16	T	A	3: 26,913,338		probably benign	Het
Srfbp1	A	G	18: 52,487,516	D102G	probably damaging	Het
Srrm3	A	C	5: 135,873,282		probably benign	Het
Tbl1xr1	T	A	3: 22,200,587		probably benign	Het
Tk1	T	C	11: 117,822,107	E98G	probably damaging	Het
Trim13	G	A	14: 61,605,700	V389I	probably benign	Het
Ttc28	A	T	5: 111,235,500	Y1289F	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ugt1a10	T	A	1: 88,056,182	V234D	probably benign	Het
Vmn2r75	C	T	7: 86,165,367	G306E	probably benign	Het
Vmn2r86	C	T	10: 130,453,628	V133I	probably benign	Het
Vps13c	C	A	9: 67,934,476	Q1927K	probably benign	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp219	T	A	14: 52,006,938	T550S	probably benign	Het
Zfp329	T	A	7: 12,811,468	N43I	probably benign	Het

Other mutations in Kcnma1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01318:Kcnma1	APN	14	23314322	splice site	probably benign
IGL01520:Kcnma1	APN	14	23501143	missense	possibly damaging	0.94
IGL01977:Kcnma1	APN	14	23530299	splice site	probably benign
IGL02140:Kcnma1	APN	14	23309045	missense	probably damaging	1.00
IGL02165:Kcnma1	APN	14	23336967	missense	possibly damaging	0.93
IGL02186:Kcnma1	APN	14	23526813	missense	probably benign	0.28
IGL02268:Kcnma1	APN	14	23543076	missense	probably damaging	1.00
IGL02353:Kcnma1	APN	14	23591613	missense	probably damaging	1.00
IGL02360:Kcnma1	APN	14	23591613	missense	probably damaging	1.00
IGL02491:Kcnma1	APN	14	23311689	missense	probably damaging	1.00
IGL02552:Kcnma1	APN	14	23386259	critical splice donor site	probably null
IGL02625:Kcnma1	APN	14	23363832	missense	probably damaging	1.00
IGL02677:Kcnma1	APN	14	23463156	missense	probably damaging	1.00
IGL02706:Kcnma1	APN	14	23309154	missense	probably damaging	1.00
G1citation:Kcnma1	UTSW	14	24003744	splice site	probably null
PIT4495001:Kcnma1	UTSW	14	23425597	missense	probably benign	0.00
PIT4514001:Kcnma1	UTSW	14	23309035	splice site	probably null
PIT4576001:Kcnma1	UTSW	14	23309035	splice site	probably null
R0071:Kcnma1	UTSW	14	23526767	missense	probably damaging	1.00
R0071:Kcnma1	UTSW	14	23526767	missense	probably damaging	1.00
R0115:Kcnma1	UTSW	14	23314175	missense	probably damaging	1.00
R0172:Kcnma1	UTSW	14	23803166	missense	probably damaging	1.00
R0178:Kcnma1	UTSW	14	23526767	missense	probably damaging	1.00
R0183:Kcnma1	UTSW	14	23508052	missense	probably damaging	1.00
R0240:Kcnma1	UTSW	14	23494579	missense	probably damaging	1.00
R0240:Kcnma1	UTSW	14	23494579	missense	probably damaging	1.00
R0328:Kcnma1	UTSW	14	23373197	missense	probably damaging	1.00
R0501:Kcnma1	UTSW	14	23311716	missense	possibly damaging	0.80
R0631:Kcnma1	UTSW	14	23509784	splice site	probably benign
R0668:Kcnma1	UTSW	14	23367495	missense	probably damaging	1.00
R0812:Kcnma1	UTSW	14	23300018	missense	probably damaging	0.96
R1080:Kcnma1	UTSW	14	23494607	missense	probably damaging	1.00
R1419:Kcnma1	UTSW	14	23367642	missense	probably damaging	0.99
R1446:Kcnma1	UTSW	14	23311724	missense	probably damaging	1.00
R1454:Kcnma1	UTSW	14	23463200	missense	probably damaging	1.00
R1651:Kcnma1	UTSW	14	23314194	missense	probably damaging	1.00
R1826:Kcnma1	UTSW	14	23330929	missense	probably damaging	1.00
R1827:Kcnma1	UTSW	14	23330929	missense	probably damaging	1.00
R1828:Kcnma1	UTSW	14	23330929	missense	probably damaging	1.00
R1864:Kcnma1	UTSW	14	23803162	missense	probably damaging	1.00
R2002:Kcnma1	UTSW	14	23337029	missense	probably damaging	0.99
R2140:Kcnma1	UTSW	14	23314220	missense	probably damaging	1.00
R2278:Kcnma1	UTSW	14	23543083	nonsense	probably null
R2866:Kcnma1	UTSW	14	23373207	missense	probably benign	0.16
R2867:Kcnma1	UTSW	14	23373207	missense	probably benign	0.16
R2867:Kcnma1	UTSW	14	23373207	missense	probably benign	0.16
R2900:Kcnma1	UTSW	14	23803160	missense	probably damaging	1.00
R3820:Kcnma1	UTSW	14	23299938	missense	possibly damaging	0.66
R3821:Kcnma1	UTSW	14	23367611	missense	probably damaging	1.00
R3901:Kcnma1	UTSW	14	23505255	missense	probably damaging	0.98
R3975:Kcnma1	UTSW	14	24003747	critical splice donor site	probably null
R3976:Kcnma1	UTSW	14	24003747	critical splice donor site	probably null
R4352:Kcnma1	UTSW	14	23311652	missense	probably damaging	1.00
R4517:Kcnma1	UTSW	14	23337029	missense	probably damaging	1.00
R4598:Kcnma1	UTSW	14	23803160	missense	probably damaging	1.00
R4604:Kcnma1	UTSW	14	23309038	critical splice donor site	probably null
R4743:Kcnma1	UTSW	14	23803202	missense	probably damaging	1.00
R4754:Kcnma1	UTSW	14	23363836	missense	probably damaging	0.96
R4908:Kcnma1	UTSW	14	23309152	missense	probably damaging	0.99
R4960:Kcnma1	UTSW	14	24004118	intron	probably benign
R5175:Kcnma1	UTSW	14	23336038	critical splice donor site	probably null
R5218:Kcnma1	UTSW	14	23463185	missense	probably damaging	0.96
R5435:Kcnma1	UTSW	14	23528404	nonsense	probably null
R5705:Kcnma1	UTSW	14	24003771	missense	possibly damaging	0.73
R5746:Kcnma1	UTSW	14	23494567	missense	probably damaging	1.00
R5780:Kcnma1	UTSW	14	23386351	nonsense	probably null
R5793:Kcnma1	UTSW	14	23309035	splice site	probably null
R6039:Kcnma1	UTSW	14	23309037	missense	probably benign	0.42
R6039:Kcnma1	UTSW	14	23309037	missense	probably benign	0.42
R6133:Kcnma1	UTSW	14	24003868	missense	probably damaging	0.98
R6271:Kcnma1	UTSW	14	23509889	missense	probably damaging	1.00
R6490:Kcnma1	UTSW	14	23336097	missense	possibly damaging	0.46
R6704:Kcnma1	UTSW	14	24002814	nonsense	probably null
R6822:Kcnma1	UTSW	14	24003744	splice site	probably null
R6855:Kcnma1	UTSW	14	23367611	missense	probably damaging	1.00
R6920:Kcnma1	UTSW	14	23526534	critical splice donor site	probably null
R7017:Kcnma1	UTSW	14	23494643	missense	possibly damaging	0.79
R7081:Kcnma1	UTSW	14	23300018	missense	probably damaging	0.96
R7113:Kcnma1	UTSW	14	23463156	missense	probably damaging	1.00
R7131:Kcnma1	UTSW	14	23367494	missense	probably damaging	1.00
R7172:Kcnma1	UTSW	14	23526623	missense	probably damaging	1.00
R7207:Kcnma1	UTSW	14	23309015	makesense	probably null
R7308:Kcnma1	UTSW	14	23330935	missense	probably damaging	0.99
R7371:Kcnma1	UTSW	14	23494570	missense	possibly damaging	0.94
R7404:Kcnma1	UTSW	14	24002834	missense	unknown
R7560:Kcnma1	UTSW	14	23530242	missense	probably benign	0.15
R7693:Kcnma1	UTSW	14	23367612	missense	probably damaging	1.00
R7763:Kcnma1	UTSW	14	23300006	missense	possibly damaging	0.66
R7809:Kcnma1	UTSW	14	23373256	missense	probably benign	0.16
R7832:Kcnma1	UTSW	14	23390923	missense	probably benign
R7884:Kcnma1	UTSW	14	23336989	missense	probably benign	0.01
R8013:Kcnma1	UTSW	14	23373143	missense	probably benign	0.31
R8014:Kcnma1	UTSW	14	23373143	missense	probably benign	0.31
R8066:Kcnma1	UTSW	14	23311676	missense	probably benign	0.00
R8097:Kcnma1	UTSW	14	23330964	missense	probably damaging	1.00
R8154:Kcnma1	UTSW	14	23311754	missense	possibly damaging	0.62
R8507:Kcnma1	UTSW	14	23591638	missense	probably benign	0.00
R8672:Kcnma1	UTSW	14	23501162	missense	probably damaging	1.00
R8677:Kcnma1	UTSW	14	23386350	missense	probably benign	0.36
R8725:Kcnma1	UTSW	14	23386264	missense	probably benign	0.00
R8727:Kcnma1	UTSW	14	23386264	missense	probably benign	0.00
R8827:Kcnma1	UTSW	14	23367480	missense	probably damaging	1.00
R8880:Kcnma1	UTSW	14	23367650	missense	probably damaging	1.00
R8997:Kcnma1	UTSW	14	23462969	intron	probably benign
R9056:Kcnma1	UTSW	14	23650146	missense	possibly damaging	0.80
R9346:Kcnma1	UTSW	14	23650165	missense	possibly damaging	0.94
R9403:Kcnma1	UTSW	14	23543077	missense	probably benign	0.05
R9438:Kcnma1	UTSW	14	23367585	missense	probably benign	0.00
R9482:Kcnma1	UTSW	14	23390965	missense	probably benign
R9511:Kcnma1	UTSW	14	23311725	missense	possibly damaging	0.90
R9649:Kcnma1	UTSW	14	23451598	critical splice donor site	probably null
R9663:Kcnma1	UTSW	14	24003829	missense	probably benign	0.15
R9673:Kcnma1	UTSW	14	23508055	missense	probably benign	0.01
RF001:Kcnma1	UTSW	14	23311697	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACCAGTGATTCAGCATGTAAGAGG -3'
(R):5'- TTCACTTGCTACAGGGAGGAGAGG -3'

Sequencing Primer
(F):5'- CGTCACCATTTATGAAGTTTGTCAGG -3'
(R):5'- AGAGGCATGGTTCAGGTTTCG -3'

Posted On

2013-10-16