Mutagenetix > Incidental Mutation

Incidental Mutation 'R0811:Grid1'

78532

Institutional Source

Beutler Lab

Gene Symbol

Grid1

Ensembl Gene

ENSMUSG00000041078

Gene Name

glutamate receptor, ionotropic, delta 1

Synonyms

GluRdelta1

MMRRC Submission

038991-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R0811 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34820108-35583379 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 34822619 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 49 (S49N)

Ref Sequence

ENSEMBL: ENSMUSP00000044009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043349]

AlphaFold

Q61627

Predicted Effect

probably benign
Transcript: ENSMUST00000043349
AA Change: S49N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: S49N

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	36	400	4.1e-51	PFAM
PBPe	438	807	4.68e-110	SMART
Lig_chan-Glu_bd	448	510	8.18e-25	SMART
low complexity region	838	853	N/A	INTRINSIC
low complexity region	943	958	N/A	INTRINSIC

Meta Mutation Damage Score

0.0690

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.3%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	G	2: 130,713,414	F858S	probably damaging	Het
Abcb1a	T	C	5: 8,713,229	S586P	probably damaging	Het
Ap5z1	G	A	5: 142,475,791	R583H	probably benign	Het
Arhgap28	TCAGCAGCAGCAGCAGCAGCAG	TCAGCAGCAGCAGCAGCAG	17: 67,901,299		probably benign	Het
Arrb1	G	T	7: 99,598,501	V346L	probably benign	Het
Atrnl1	T	A	19: 57,673,141	F518I	probably benign	Het
Bank1	T	A	3: 136,093,366	I405F	probably damaging	Het
Cacna1h	A	G	17: 25,388,628	L905P	probably damaging	Het
Cc2d1a	A	G	8: 84,133,836	Y826H	probably benign	Het
Cenpo	A	G	12: 4,216,643	V155A	probably benign	Het
Cnmd	A	G	14: 79,661,423	F63S	probably damaging	Het
Cnn3	G	A	3: 121,454,951	G72D	probably damaging	Het
Cox10	A	G	11: 64,071,713	S101P	probably benign	Het
Ctdsp1	T	C	1: 74,394,647	V129A	probably damaging	Het
Cyp2d34	A	T	15: 82,618,606	S140T	probably benign	Het
Dennd5a	G	A	7: 109,933,613	H317Y	possibly damaging	Het
Eef2	C	CN	10: 81,178,769		probably null	Het
Enox1	T	A	14: 77,582,436	D210E	probably damaging	Het
Fam171a1	A	G	2: 3,197,427	N190S	probably damaging	Het
Fat2	T	A	11: 55,253,633	K4138N	possibly damaging	Het
Fat4	A	T	3: 38,957,474	D2241V	probably damaging	Het
Fbn1	C	T	2: 125,403,170	V266I	possibly damaging	Het
Fras1	T	A	5: 96,752,998	S3025R	probably benign	Het
Gba	T	C	3: 89,204,000	I24T	probably benign	Het
Gdpd5	A	G	7: 99,438,333	D68G	probably damaging	Het
Grtp1	T	C	8: 13,179,639	T250A	possibly damaging	Het
Gucy1b1	T	C	3: 82,037,988	N448D	probably benign	Het
Hmcn2	G	A	2: 31,420,371	A3326T	probably damaging	Het
Ippk	C	A	13: 49,443,471	Q254K	probably damaging	Het
Itga2	A	T	13: 114,870,614	L393I	possibly damaging	Het
Kcna10	A	T	3: 107,195,259	E402V	possibly damaging	Het
Kcnab1	G	A	3: 65,297,720	D119N	probably damaging	Het
Kcnip4	T	A	5: 48,409,860	T122S	probably benign	Het
Kcnma1	G	A	14: 23,300,018	P1151L	probably damaging	Het
Klhl22	T	A	16: 17,792,589	M568K	probably benign	Het
Krt6a	C	T	15: 101,692,748	V257M	probably damaging	Het
Ksr2	A	C	5: 117,555,225	H246P	probably damaging	Het
Lca5	T	C	9: 83,399,753	D326G	possibly damaging	Het
Lcp1	A	G	14: 75,214,488	E393G	probably benign	Het
Leo1	G	A	9: 75,445,549	E125K	probably benign	Het
Lipt1	T	A	1: 37,875,301	V146E	probably damaging	Het
Mael	A	T	1: 166,235,399		probably null	Het
Mga	C	T	2: 119,947,961	L1996F	probably damaging	Het
Mllt6	A	G	11: 97,678,561	N913S	probably damaging	Het
Mphosph9	A	C	5: 124,298,759	D507E	probably damaging	Het
Mvp	G	A	7: 126,987,556	A801V	probably benign	Het
Neb	T	C	2: 52,292,695	D1053G	possibly damaging	Het
Nubp1	C	A	16: 10,413,721	L79I	probably benign	Het
Olfr397	G	A	11: 73,965,420	E271K	probably benign	Het
Olfr924	G	A	9: 38,848,509	V132I	probably benign	Het
Olfr97	A	C	17: 37,232,332	L13V	probably benign	Het
Pithd1	A	G	4: 135,977,134		probably benign	Het
Pnpla8	G	A	12: 44,283,405	V29M	probably benign	Het
Psmb2	T	A	4: 126,707,557	I151N	possibly damaging	Het
Ptgs2	C	T	1: 150,101,354	T104I	probably benign	Het
Ptpro	A	G	6: 137,368,079	T28A	probably benign	Het
Raf1	A	G	6: 115,626,710		probably null	Het
Ranbp2	T	C	10: 58,465,529	M668T	probably benign	Het
Rbm48	A	T	5: 3,591,760		probably null	Het
Rhag	A	T	17: 40,831,578	T225S	possibly damaging	Het
Rhof	A	C	5: 123,131,887	L69R	probably damaging	Het
Slc22a1	T	C	17: 12,666,618		probably benign	Het
Slc24a5	T	C	2: 125,068,804	S52P	probably damaging	Het
Slc8a2	T	C	7: 16,141,114	V429A	probably damaging	Het
Spam1	G	A	6: 24,796,887	R279H	probably damaging	Het
Spata16	T	A	3: 26,913,338		probably benign	Het
Srfbp1	A	G	18: 52,487,516	D102G	probably damaging	Het
Srrm3	A	C	5: 135,873,282		probably benign	Het
Tbl1xr1	T	A	3: 22,200,587		probably benign	Het
Tk1	T	C	11: 117,822,107	E98G	probably damaging	Het
Trim13	G	A	14: 61,605,700	V389I	probably benign	Het
Ttc28	A	T	5: 111,235,500	Y1289F	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ugt1a10	T	A	1: 88,056,182	V234D	probably benign	Het
Vmn2r75	C	T	7: 86,165,367	G306E	probably benign	Het
Vmn2r86	C	T	10: 130,453,628	V133I	probably benign	Het
Vps13c	C	A	9: 67,934,476	Q1927K	probably benign	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp219	T	A	14: 52,006,938	T550S	probably benign	Het
Zfp329	T	A	7: 12,811,468	N43I	probably benign	Het

Other mutations in Grid1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00705:Grid1	APN	14	35445887	missense	possibly damaging	0.70
IGL01016:Grid1	APN	14	34822639	nonsense	probably null
IGL01643:Grid1	APN	14	35323435	critical splice donor site	probably null
IGL01697:Grid1	APN	14	35309257	missense	probably benign	0.21
IGL01879:Grid1	APN	14	35450370	missense	possibly damaging	0.93
IGL01975:Grid1	APN	14	35323426	missense	probably benign
IGL02515:Grid1	APN	14	35452345	missense	probably damaging	0.99
IGL02935:Grid1	APN	14	34822558	missense	possibly damaging	0.86
IGL03279:Grid1	APN	14	34945765	missense	probably damaging	0.98
IGL03286:Grid1	APN	14	35520685	splice site	probably benign
IGL03296:Grid1	APN	14	35580567	missense	possibly damaging	0.52
IGL03305:Grid1	APN	14	35251707	missense	probably damaging	1.00
R0533:Grid1	UTSW	14	35309385	missense	possibly damaging	0.84
R0746:Grid1	UTSW	14	34822690	missense	possibly damaging	0.92
R0812:Grid1	UTSW	14	34822619	missense	probably benign
R1144:Grid1	UTSW	14	35562676	splice site	probably benign
R1217:Grid1	UTSW	14	34820229	start codon destroyed	probably null	0.53
R1485:Grid1	UTSW	14	34822583	missense	probably damaging	1.00
R1529:Grid1	UTSW	14	35309293	missense	probably benign	0.36
R1606:Grid1	UTSW	14	35445965	missense	probably damaging	0.96
R1691:Grid1	UTSW	14	35452329	missense	probably damaging	1.00
R1759:Grid1	UTSW	14	35446031	missense	possibly damaging	0.92
R2374:Grid1	UTSW	14	35321807	splice site	probably benign
R2415:Grid1	UTSW	14	35450369	missense	possibly damaging	0.69
R2866:Grid1	UTSW	14	35562559	missense	probably damaging	1.00
R3915:Grid1	UTSW	14	35520727	missense	probably damaging	1.00
R4044:Grid1	UTSW	14	35450401	splice site	probably benign
R4364:Grid1	UTSW	14	34946032	missense	probably benign	0.20
R4691:Grid1	UTSW	14	35569557	missense	probably benign
R4694:Grid1	UTSW	14	35026780	missense	probably damaging	1.00
R4749:Grid1	UTSW	14	35580687	missense	possibly damaging	0.50
R4794:Grid1	UTSW	14	34822622	missense	probably damaging	0.99
R4854:Grid1	UTSW	14	35321641	missense	probably benign
R5555:Grid1	UTSW	14	35520705	missense	possibly damaging	0.92
R6005:Grid1	UTSW	14	35323412	missense	probably damaging	1.00
R6176:Grid1	UTSW	14	35562547	missense	probably benign	0.00
R6569:Grid1	UTSW	14	35323339	missense	possibly damaging	0.72
R6911:Grid1	UTSW	14	34820228	start codon destroyed	probably benign	0.08
R7504:Grid1	UTSW	14	35562513	missense	probably damaging	1.00
R7744:Grid1	UTSW	14	35450079	missense	probably damaging	1.00
R7795:Grid1	UTSW	14	35321685	missense	probably damaging	1.00
R7883:Grid1	UTSW	14	35450302	splice site	probably null
R7913:Grid1	UTSW	14	35569697	missense	probably damaging	0.99
R8032:Grid1	UTSW	14	35323359	missense	probably benign	0.00
R8333:Grid1	UTSW	14	35569638	missense	possibly damaging	0.82
R8916:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8928:Grid1	UTSW	14	35580766	missense	probably benign	0.25
R8934:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8935:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8939:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8986:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8993:Grid1	UTSW	14	35026942	missense	probably benign	0.00
R9238:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9310:Grid1	UTSW	14	35026805	missense	probably damaging	1.00
R9332:Grid1	UTSW	14	35323403	missense	probably benign	0.06
R9335:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9336:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9478:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9479:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9496:Grid1	UTSW	14	35569614	missense	probably damaging	1.00
R9583:Grid1	UTSW	14	35580535	missense	possibly damaging	0.90
R9601:Grid1	UTSW	14	35445857	missense	probably damaging	0.99
R9734:Grid1	UTSW	14	35580785	missense	probably benign
U24488:Grid1	UTSW	14	35580577	missense	probably benign	0.00
Z1088:Grid1	UTSW	14	35452294	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAACACACCCCGTTTGGGTTATG -3'
(R):5'- TCTGTACAACGGATTGGGTAGCAAC -3'

Sequencing Primer
(F):5'- ggggcacagaaggagaac -3'
(R):5'- TAGCAACCCTGCCTGGAC -3'

Posted On

2013-10-16