Mutagenetix > Incidental Mutation

Incidental Mutation 'R0811:Lcp1'

78534

Institutional Source

Beutler Lab

Gene Symbol

Lcp1

Ensembl Gene

ENSMUSG00000021998

Gene Name

lymphocyte cytosolic protein 1

Synonyms

D14Ertd310e, L-fimbrin, Pls2, L-plastin

MMRRC Submission

038991-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0811 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75131101-75230842 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75214488 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 393 (E393G)

Ref Sequence

ENSEMBL: ENSMUSP00000116271 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124499] [ENSMUST00000131802] [ENSMUST00000145303]

AlphaFold

Q61233

Predicted Effect

probably benign
Transcript: ENSMUST00000124499
AA Change: E393G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: E393G

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131802
AA Change: E393G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: E393G

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000145303
AA Change: E393G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: E393G

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Meta Mutation Damage Score

0.2621

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.3%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	G	2: 130,713,414	F858S	probably damaging	Het
Abcb1a	T	C	5: 8,713,229	S586P	probably damaging	Het
Ap5z1	G	A	5: 142,475,791	R583H	probably benign	Het
Arhgap28	TCAGCAGCAGCAGCAGCAGCAG	TCAGCAGCAGCAGCAGCAG	17: 67,901,299		probably benign	Het
Arrb1	G	T	7: 99,598,501	V346L	probably benign	Het
Atrnl1	T	A	19: 57,673,141	F518I	probably benign	Het
Bank1	T	A	3: 136,093,366	I405F	probably damaging	Het
Cacna1h	A	G	17: 25,388,628	L905P	probably damaging	Het
Cc2d1a	A	G	8: 84,133,836	Y826H	probably benign	Het
Cenpo	A	G	12: 4,216,643	V155A	probably benign	Het
Cnmd	A	G	14: 79,661,423	F63S	probably damaging	Het
Cnn3	G	A	3: 121,454,951	G72D	probably damaging	Het
Cox10	A	G	11: 64,071,713	S101P	probably benign	Het
Ctdsp1	T	C	1: 74,394,647	V129A	probably damaging	Het
Cyp2d34	A	T	15: 82,618,606	S140T	probably benign	Het
Dennd5a	G	A	7: 109,933,613	H317Y	possibly damaging	Het
Eef2	C	CN	10: 81,178,769		probably null	Het
Enox1	T	A	14: 77,582,436	D210E	probably damaging	Het
Fam171a1	A	G	2: 3,197,427	N190S	probably damaging	Het
Fat2	T	A	11: 55,253,633	K4138N	possibly damaging	Het
Fat4	A	T	3: 38,957,474	D2241V	probably damaging	Het
Fbn1	C	T	2: 125,403,170	V266I	possibly damaging	Het
Fras1	T	A	5: 96,752,998	S3025R	probably benign	Het
Gba	T	C	3: 89,204,000	I24T	probably benign	Het
Gdpd5	A	G	7: 99,438,333	D68G	probably damaging	Het
Grid1	G	A	14: 34,822,619	S49N	probably benign	Het
Grtp1	T	C	8: 13,179,639	T250A	possibly damaging	Het
Gucy1b1	T	C	3: 82,037,988	N448D	probably benign	Het
Hmcn2	G	A	2: 31,420,371	A3326T	probably damaging	Het
Ippk	C	A	13: 49,443,471	Q254K	probably damaging	Het
Itga2	A	T	13: 114,870,614	L393I	possibly damaging	Het
Kcna10	A	T	3: 107,195,259	E402V	possibly damaging	Het
Kcnab1	G	A	3: 65,297,720	D119N	probably damaging	Het
Kcnip4	T	A	5: 48,409,860	T122S	probably benign	Het
Kcnma1	G	A	14: 23,300,018	P1151L	probably damaging	Het
Klhl22	T	A	16: 17,792,589	M568K	probably benign	Het
Krt6a	C	T	15: 101,692,748	V257M	probably damaging	Het
Ksr2	A	C	5: 117,555,225	H246P	probably damaging	Het
Lca5	T	C	9: 83,399,753	D326G	possibly damaging	Het
Leo1	G	A	9: 75,445,549	E125K	probably benign	Het
Lipt1	T	A	1: 37,875,301	V146E	probably damaging	Het
Mael	A	T	1: 166,235,399		probably null	Het
Mga	C	T	2: 119,947,961	L1996F	probably damaging	Het
Mllt6	A	G	11: 97,678,561	N913S	probably damaging	Het
Mphosph9	A	C	5: 124,298,759	D507E	probably damaging	Het
Mvp	G	A	7: 126,987,556	A801V	probably benign	Het
Neb	T	C	2: 52,292,695	D1053G	possibly damaging	Het
Nubp1	C	A	16: 10,413,721	L79I	probably benign	Het
Olfr397	G	A	11: 73,965,420	E271K	probably benign	Het
Olfr924	G	A	9: 38,848,509	V132I	probably benign	Het
Olfr97	A	C	17: 37,232,332	L13V	probably benign	Het
Pithd1	A	G	4: 135,977,134		probably benign	Het
Pnpla8	G	A	12: 44,283,405	V29M	probably benign	Het
Psmb2	T	A	4: 126,707,557	I151N	possibly damaging	Het
Ptgs2	C	T	1: 150,101,354	T104I	probably benign	Het
Ptpro	A	G	6: 137,368,079	T28A	probably benign	Het
Raf1	A	G	6: 115,626,710		probably null	Het
Ranbp2	T	C	10: 58,465,529	M668T	probably benign	Het
Rbm48	A	T	5: 3,591,760		probably null	Het
Rhag	A	T	17: 40,831,578	T225S	possibly damaging	Het
Rhof	A	C	5: 123,131,887	L69R	probably damaging	Het
Slc22a1	T	C	17: 12,666,618		probably benign	Het
Slc24a5	T	C	2: 125,068,804	S52P	probably damaging	Het
Slc8a2	T	C	7: 16,141,114	V429A	probably damaging	Het
Spam1	G	A	6: 24,796,887	R279H	probably damaging	Het
Spata16	T	A	3: 26,913,338		probably benign	Het
Srfbp1	A	G	18: 52,487,516	D102G	probably damaging	Het
Srrm3	A	C	5: 135,873,282		probably benign	Het
Tbl1xr1	T	A	3: 22,200,587		probably benign	Het
Tk1	T	C	11: 117,822,107	E98G	probably damaging	Het
Trim13	G	A	14: 61,605,700	V389I	probably benign	Het
Ttc28	A	T	5: 111,235,500	Y1289F	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ugt1a10	T	A	1: 88,056,182	V234D	probably benign	Het
Vmn2r75	C	T	7: 86,165,367	G306E	probably benign	Het
Vmn2r86	C	T	10: 130,453,628	V133I	probably benign	Het
Vps13c	C	A	9: 67,934,476	Q1927K	probably benign	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp219	T	A	14: 52,006,938	T550S	probably benign	Het
Zfp329	T	A	7: 12,811,468	N43I	probably benign	Het

Other mutations in Lcp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Lcp1	APN	14	75227093	critical splice donor site	probably null
IGL01768:Lcp1	APN	14	75224133	missense	probably benign	0.40
IGL01801:Lcp1	APN	14	75199375	missense	probably benign	0.10
IGL01940:Lcp1	APN	14	75216365	missense	probably benign	0.17
IGL02135:Lcp1	APN	14	75200486	missense	probably benign	0.00
IGL02185:Lcp1	APN	14	75229300	missense	possibly damaging	0.73
IGL02478:Lcp1	APN	14	75224096	missense	probably benign	0.04
IGL02604:Lcp1	APN	14	75224126	missense	probably benign	0.11
R0244:Lcp1	UTSW	14	75227001	missense	possibly damaging	0.92
R0295:Lcp1	UTSW	14	75199420	missense	probably null	0.59
R0313:Lcp1	UTSW	14	75199433	missense	probably damaging	1.00
R0415:Lcp1	UTSW	14	75227006	missense	possibly damaging	0.88
R0751:Lcp1	UTSW	14	75199387	missense	probably benign	0.00
R0812:Lcp1	UTSW	14	75214488	missense	probably benign	0.00
R1200:Lcp1	UTSW	14	75229302	missense	possibly damaging	0.73
R1713:Lcp1	UTSW	14	75199444	critical splice donor site	probably null
R1915:Lcp1	UTSW	14	75199297	missense	possibly damaging	0.81
R1969:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R1970:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R1971:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R2045:Lcp1	UTSW	14	75200401	missense	probably benign	0.01
R2064:Lcp1	UTSW	14	75198075	critical splice acceptor site	probably null
R3949:Lcp1	UTSW	14	75206129	missense	possibly damaging	0.68
R4062:Lcp1	UTSW	14	75215180	missense	probably damaging	1.00
R4521:Lcp1	UTSW	14	75215168	missense	possibly damaging	0.94
R4811:Lcp1	UTSW	14	75200408	missense	probably damaging	0.99
R4854:Lcp1	UTSW	14	75200489	missense	probably damaging	1.00
R4974:Lcp1	UTSW	14	75208471	nonsense	probably null
R5539:Lcp1	UTSW	14	75229298	missense	probably benign	0.08
R5561:Lcp1	UTSW	14	75212508	missense	probably benign	0.01
R5724:Lcp1	UTSW	14	75226982	missense	probably benign	0.18
R5989:Lcp1	UTSW	14	75199387	missense	probably benign	0.00
R6731:Lcp1	UTSW	14	75206189	missense	probably damaging	1.00
R7346:Lcp1	UTSW	14	75210506	missense	possibly damaging	0.49
R7670:Lcp1	UTSW	14	75200431	missense	probably benign	0.12
R7698:Lcp1	UTSW	14	75206211	nonsense	probably null
R9780:Lcp1	UTSW	14	75202738	missense	probably damaging	1.00
S24628:Lcp1	UTSW	14	75227006	missense	possibly damaging	0.88
X0027:Lcp1	UTSW	14	75227086	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAATCTGGGCTATGTTGTCCCGTC -3'
(R):5'- ACATTTGGGAAGGACACACGCAC -3'

Sequencing Primer
(F):5'- GTGCCTCCAAATCTTGTTCGATG -3'
(R):5'- CGCACCACAGTGATACGG -3'

Posted On

2013-10-16