Incidental Mutation 'R0811:Atrnl1'
Institutional Source Beutler Lab
Gene Symbol Atrnl1
Ensembl Gene ENSMUSG00000054843
Gene Nameattractin like 1
MMRRC Submission 038991-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R0811 (G1)
Quality Score180
Status Validated
Chromosomal Location57611034-58133338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57673141 bp
Amino Acid Change Phenylalanine to Isoleucine at position 518 (F518I)
Ref Sequence ENSEMBL: ENSMUSP00000076514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077282]
Predicted Effect probably benign
Transcript: ENSMUST00000077282
AA Change: F518I

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: F518I

low complexity region 25 32 N/A INTRINSIC
EGF 61 90 5.71e-1 SMART
CUB 92 208 1.43e-11 SMART
EGF 209 244 1.95e1 SMART
Pfam:EGF_2 248 279 5.8e-7 PFAM
Pfam:Kelch_5 350 391 2.1e-9 PFAM
Pfam:Kelch_6 354 401 5.8e-8 PFAM
Pfam:Kelch_4 465 517 4.3e-7 PFAM
Pfam:Kelch_1 519 573 2.7e-6 PFAM
PSI 613 656 3.38e-1 SMART
PSI 665 708 2e-3 SMART
PSI 714 759 1.72e-2 SMART
CLECT 747 872 2.86e-20 SMART
PSI 888 938 6.26e-5 SMART
PSI 941 1011 1.73e-7 SMART
EGF_Lam 1013 1056 1.07e-5 SMART
low complexity region 1157 1173 N/A INTRINSIC
transmembrane domain 1229 1251 N/A INTRINSIC
low complexity region 1261 1272 N/A INTRINSIC
low complexity region 1326 1339 N/A INTRINSIC
Meta Mutation Damage Score 0.0891 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,713,414 F858S probably damaging Het
Abcb1a T C 5: 8,713,229 S586P probably damaging Het
Ap5z1 G A 5: 142,475,791 R583H probably benign Het
Arhgap28 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG 17: 67,901,299 probably benign Het
Arrb1 G T 7: 99,598,501 V346L probably benign Het
Bank1 T A 3: 136,093,366 I405F probably damaging Het
Cacna1h A G 17: 25,388,628 L905P probably damaging Het
Cc2d1a A G 8: 84,133,836 Y826H probably benign Het
Cenpo A G 12: 4,216,643 V155A probably benign Het
Cnmd A G 14: 79,661,423 F63S probably damaging Het
Cnn3 G A 3: 121,454,951 G72D probably damaging Het
Cox10 A G 11: 64,071,713 S101P probably benign Het
Ctdsp1 T C 1: 74,394,647 V129A probably damaging Het
Cyp2d34 A T 15: 82,618,606 S140T probably benign Het
Dennd5a G A 7: 109,933,613 H317Y possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Enox1 T A 14: 77,582,436 D210E probably damaging Het
Fam171a1 A G 2: 3,197,427 N190S probably damaging Het
Fat2 T A 11: 55,253,633 K4138N possibly damaging Het
Fat4 A T 3: 38,957,474 D2241V probably damaging Het
Fbn1 C T 2: 125,403,170 V266I possibly damaging Het
Fras1 T A 5: 96,752,998 S3025R probably benign Het
Gba T C 3: 89,204,000 I24T probably benign Het
Gdpd5 A G 7: 99,438,333 D68G probably damaging Het
Grid1 G A 14: 34,822,619 S49N probably benign Het
Grtp1 T C 8: 13,179,639 T250A possibly damaging Het
Gucy1b1 T C 3: 82,037,988 N448D probably benign Het
Hmcn2 G A 2: 31,420,371 A3326T probably damaging Het
Ippk C A 13: 49,443,471 Q254K probably damaging Het
Itga2 A T 13: 114,870,614 L393I possibly damaging Het
Kcna10 A T 3: 107,195,259 E402V possibly damaging Het
Kcnab1 G A 3: 65,297,720 D119N probably damaging Het
Kcnip4 T A 5: 48,409,860 T122S probably benign Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Klhl22 T A 16: 17,792,589 M568K probably benign Het
Krt6a C T 15: 101,692,748 V257M probably damaging Het
Ksr2 A C 5: 117,555,225 H246P probably damaging Het
Lca5 T C 9: 83,399,753 D326G possibly damaging Het
Lcp1 A G 14: 75,214,488 E393G probably benign Het
Leo1 G A 9: 75,445,549 E125K probably benign Het
Lipt1 T A 1: 37,875,301 V146E probably damaging Het
Mael A T 1: 166,235,399 probably null Het
Mga C T 2: 119,947,961 L1996F probably damaging Het
Mllt6 A G 11: 97,678,561 N913S probably damaging Het
Mphosph9 A C 5: 124,298,759 D507E probably damaging Het
Mvp G A 7: 126,987,556 A801V probably benign Het
Neb T C 2: 52,292,695 D1053G possibly damaging Het
Nubp1 C A 16: 10,413,721 L79I probably benign Het
Olfr397 G A 11: 73,965,420 E271K probably benign Het
Olfr924 G A 9: 38,848,509 V132I probably benign Het
Olfr97 A C 17: 37,232,332 L13V probably benign Het
Pithd1 A G 4: 135,977,134 probably benign Het
Pnpla8 G A 12: 44,283,405 V29M probably benign Het
Psmb2 T A 4: 126,707,557 I151N possibly damaging Het
Ptgs2 C T 1: 150,101,354 T104I probably benign Het
Ptpro A G 6: 137,368,079 T28A probably benign Het
Raf1 A G 6: 115,626,710 probably null Het
Ranbp2 T C 10: 58,465,529 M668T probably benign Het
Rbm48 A T 5: 3,591,760 probably null Het
Rhag A T 17: 40,831,578 T225S possibly damaging Het
Rhof A C 5: 123,131,887 L69R probably damaging Het
Slc22a1 T C 17: 12,666,618 probably benign Het
Slc24a5 T C 2: 125,068,804 S52P probably damaging Het
Slc8a2 T C 7: 16,141,114 V429A probably damaging Het
Spam1 G A 6: 24,796,887 R279H probably damaging Het
Spata16 T A 3: 26,913,338 probably benign Het
Srfbp1 A G 18: 52,487,516 D102G probably damaging Het
Srrm3 A C 5: 135,873,282 probably benign Het
Tbl1xr1 T A 3: 22,200,587 probably benign Het
Tk1 T C 11: 117,822,107 E98G probably damaging Het
Trim13 G A 14: 61,605,700 V389I probably benign Het
Ttc28 A T 5: 111,235,500 Y1289F probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt1a10 T A 1: 88,056,182 V234D probably benign Het
Vmn2r75 C T 7: 86,165,367 G306E probably benign Het
Vmn2r86 C T 10: 130,453,628 V133I probably benign Het
Vps13c C A 9: 67,934,476 Q1927K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp219 T A 14: 52,006,938 T550S probably benign Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Atrnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Atrnl1 APN 19 57691817 missense probably benign 0.02
IGL00707:Atrnl1 APN 19 57673265 missense probably damaging 0.96
IGL00921:Atrnl1 APN 19 57702153 missense probably damaging 1.00
IGL01410:Atrnl1 APN 19 58131104 missense probably damaging 1.00
IGL01468:Atrnl1 APN 19 57699712 missense probably benign 0.02
IGL01756:Atrnl1 APN 19 57652948 missense probably benign
IGL01971:Atrnl1 APN 19 57753283 missense probably damaging 1.00
IGL02019:Atrnl1 APN 19 57691763 splice site probably benign
IGL02580:Atrnl1 APN 19 57714576 splice site probably benign
IGL02649:Atrnl1 APN 19 57650441 splice site probably benign
IGL02676:Atrnl1 APN 19 57691884 missense probably damaging 1.00
IGL03276:Atrnl1 APN 19 57652927 missense probably damaging 0.99
IGL03379:Atrnl1 APN 19 57642541 missense probably benign 0.02
Magnetogorsk UTSW 19 57630306 missense probably damaging 1.00
polar UTSW 19 57652950 missense probably benign 0.00
PIT4812001:Atrnl1 UTSW 19 57731623 missense probably benign 0.08
R0109:Atrnl1 UTSW 19 57755517 missense possibly damaging 0.78
R0308:Atrnl1 UTSW 19 57753288 missense probably benign 0.04
R0394:Atrnl1 UTSW 19 57673176 missense probably benign 0.10
R0734:Atrnl1 UTSW 19 57654861 missense probably damaging 1.00
R0812:Atrnl1 UTSW 19 57673141 missense probably benign 0.07
R1183:Atrnl1 UTSW 19 57650293 missense probably damaging 0.97
R1213:Atrnl1 UTSW 19 57638462 missense probably benign 0.25
R1344:Atrnl1 UTSW 19 57935705 critical splice donor site probably null
R1418:Atrnl1 UTSW 19 57935705 critical splice donor site probably null
R1707:Atrnl1 UTSW 19 57686737 missense probably benign 0.00
R1748:Atrnl1 UTSW 19 57714702 missense probably damaging 0.99
R2051:Atrnl1 UTSW 19 57691849 missense probably benign 0.01
R2113:Atrnl1 UTSW 19 57755616 nonsense probably null
R2130:Atrnl1 UTSW 19 57654994 missense probably damaging 1.00
R3710:Atrnl1 UTSW 19 57657114 missense probably damaging 1.00
R3916:Atrnl1 UTSW 19 57935652 missense possibly damaging 0.82
R4524:Atrnl1 UTSW 19 57630306 missense probably damaging 1.00
R4707:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4712:Atrnl1 UTSW 19 57652950 missense probably benign 0.00
R4784:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4785:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4798:Atrnl1 UTSW 19 58042361 missense probably benign
R5172:Atrnl1 UTSW 19 57685513 nonsense probably null
R5226:Atrnl1 UTSW 19 57650335 missense probably benign
R5289:Atrnl1 UTSW 19 57657082 missense probably damaging 1.00
R5372:Atrnl1 UTSW 19 57755536 missense probably benign
R5737:Atrnl1 UTSW 19 57777888 missense possibly damaging 0.84
R5782:Atrnl1 UTSW 19 57753286 missense possibly damaging 0.95
R5826:Atrnl1 UTSW 19 57630292 nonsense probably null
R6169:Atrnl1 UTSW 19 57642463 missense probably benign 0.00
R6242:Atrnl1 UTSW 19 57642478 missense probably benign 0.02
R6342:Atrnl1 UTSW 19 57638510 missense probably damaging 1.00
R6372:Atrnl1 UTSW 19 57650332 missense probably benign 0.01
R6811:Atrnl1 UTSW 19 57654961 missense probably damaging 0.98
R6897:Atrnl1 UTSW 19 58042368 missense probably benign 0.01
R7024:Atrnl1 UTSW 19 57638450 critical splice acceptor site probably null
R7085:Atrnl1 UTSW 19 57691857 missense probably damaging 1.00
R7144:Atrnl1 UTSW 19 58042352 missense probably damaging 1.00
R7259:Atrnl1 UTSW 19 57935606 nonsense probably null
R7289:Atrnl1 UTSW 19 57650414 missense probably benign 0.13
R7310:Atrnl1 UTSW 19 57642424 missense possibly damaging 0.69
R7372:Atrnl1 UTSW 19 57935646 missense possibly damaging 0.47
R7432:Atrnl1 UTSW 19 57755524 missense probably damaging 1.00
R7478:Atrnl1 UTSW 19 57696312 missense possibly damaging 0.89
R7556:Atrnl1 UTSW 19 57654846 missense probably benign
R7567:Atrnl1 UTSW 19 57699523 missense probably damaging 0.98
R7608:Atrnl1 UTSW 19 57714687 missense probably damaging 1.00
R7632:Atrnl1 UTSW 19 57630306 missense probably damaging 1.00
R7655:Atrnl1 UTSW 19 57611379 nonsense probably null
R7656:Atrnl1 UTSW 19 57611379 nonsense probably null
R7718:Atrnl1 UTSW 19 57740183 nonsense probably null
R7721:Atrnl1 UTSW 19 57696331 missense probably benign 0.00
R7726:Atrnl1 UTSW 19 57702072 missense probably damaging 1.00
R7733:Atrnl1 UTSW 19 57701988 missense probably benign 0.00
R7774:Atrnl1 UTSW 19 57699671 missense probably damaging 1.00
R8010:Atrnl1 UTSW 19 57682446 missense probably benign 0.14
R8119:Atrnl1 UTSW 19 57642463 missense probably benign 0.00
RF021:Atrnl1 UTSW 19 57642473 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2013-10-16