Mutagenetix > Incidental Mutation

Incidental Mutation 'R0811:Atrnl1'

78542

Institutional Source

Beutler Lab

Gene Symbol

Atrnl1

Ensembl Gene

ENSMUSG00000054843

Gene Name

attractin like 1

Synonyms

Alp

MMRRC Submission

038991-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R0811 (G1)

Quality Score

180

Status

Validated

Chromosome

Chromosomal Location

57611034-58133338 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 57673141 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 518 (F518I)

Ref Sequence

ENSEMBL: ENSMUSP00000076514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077282]

AlphaFold

Q6A051

Predicted Effect

probably benign
Transcript: ENSMUST00000077282
AA Change: F518I

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: F518I

Domain	Start	End	E-Value	Type
low complexity region	25	32	N/A	INTRINSIC
EGF	61	90	5.71e-1	SMART
CUB	92	208	1.43e-11	SMART
EGF	209	244	1.95e1	SMART
Pfam:EGF_2	248	279	5.8e-7	PFAM
Pfam:Kelch_5	350	391	2.1e-9	PFAM
Pfam:Kelch_6	354	401	5.8e-8	PFAM
Pfam:Kelch_4	465	517	4.3e-7	PFAM
Pfam:Kelch_1	519	573	2.7e-6	PFAM
PSI	613	656	3.38e-1	SMART
PSI	665	708	2e-3	SMART
PSI	714	759	1.72e-2	SMART
CLECT	747	872	2.86e-20	SMART
PSI	888	938	6.26e-5	SMART
PSI	941	1011	1.73e-7	SMART
EGF_Lam	1013	1056	1.07e-5	SMART
low complexity region	1157	1173	N/A	INTRINSIC
transmembrane domain	1229	1251	N/A	INTRINSIC
low complexity region	1261	1272	N/A	INTRINSIC
low complexity region	1326	1339	N/A	INTRINSIC

Meta Mutation Damage Score

0.0891

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.3%

Validation Efficiency

100% (44/44)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	G	2: 130,713,414	F858S	probably damaging	Het
Abcb1a	T	C	5: 8,713,229	S586P	probably damaging	Het
Ap5z1	G	A	5: 142,475,791	R583H	probably benign	Het
Arhgap28	TCAGCAGCAGCAGCAGCAGCAG	TCAGCAGCAGCAGCAGCAG	17: 67,901,299		probably benign	Het
Arrb1	G	T	7: 99,598,501	V346L	probably benign	Het
Bank1	T	A	3: 136,093,366	I405F	probably damaging	Het
Cacna1h	A	G	17: 25,388,628	L905P	probably damaging	Het
Cc2d1a	A	G	8: 84,133,836	Y826H	probably benign	Het
Cenpo	A	G	12: 4,216,643	V155A	probably benign	Het
Cnmd	A	G	14: 79,661,423	F63S	probably damaging	Het
Cnn3	G	A	3: 121,454,951	G72D	probably damaging	Het
Cox10	A	G	11: 64,071,713	S101P	probably benign	Het
Ctdsp1	T	C	1: 74,394,647	V129A	probably damaging	Het
Cyp2d34	A	T	15: 82,618,606	S140T	probably benign	Het
Dennd5a	G	A	7: 109,933,613	H317Y	possibly damaging	Het
Eef2	C	CN	10: 81,178,769		probably null	Het
Enox1	T	A	14: 77,582,436	D210E	probably damaging	Het
Fam171a1	A	G	2: 3,197,427	N190S	probably damaging	Het
Fat2	T	A	11: 55,253,633	K4138N	possibly damaging	Het
Fat4	A	T	3: 38,957,474	D2241V	probably damaging	Het
Fbn1	C	T	2: 125,403,170	V266I	possibly damaging	Het
Fras1	T	A	5: 96,752,998	S3025R	probably benign	Het
Gba	T	C	3: 89,204,000	I24T	probably benign	Het
Gdpd5	A	G	7: 99,438,333	D68G	probably damaging	Het
Grid1	G	A	14: 34,822,619	S49N	probably benign	Het
Grtp1	T	C	8: 13,179,639	T250A	possibly damaging	Het
Gucy1b1	T	C	3: 82,037,988	N448D	probably benign	Het
Hmcn2	G	A	2: 31,420,371	A3326T	probably damaging	Het
Ippk	C	A	13: 49,443,471	Q254K	probably damaging	Het
Itga2	A	T	13: 114,870,614	L393I	possibly damaging	Het
Kcna10	A	T	3: 107,195,259	E402V	possibly damaging	Het
Kcnab1	G	A	3: 65,297,720	D119N	probably damaging	Het
Kcnip4	T	A	5: 48,409,860	T122S	probably benign	Het
Kcnma1	G	A	14: 23,300,018	P1151L	probably damaging	Het
Klhl22	T	A	16: 17,792,589	M568K	probably benign	Het
Krt6a	C	T	15: 101,692,748	V257M	probably damaging	Het
Ksr2	A	C	5: 117,555,225	H246P	probably damaging	Het
Lca5	T	C	9: 83,399,753	D326G	possibly damaging	Het
Lcp1	A	G	14: 75,214,488	E393G	probably benign	Het
Leo1	G	A	9: 75,445,549	E125K	probably benign	Het
Lipt1	T	A	1: 37,875,301	V146E	probably damaging	Het
Mael	A	T	1: 166,235,399		probably null	Het
Mga	C	T	2: 119,947,961	L1996F	probably damaging	Het
Mllt6	A	G	11: 97,678,561	N913S	probably damaging	Het
Mphosph9	A	C	5: 124,298,759	D507E	probably damaging	Het
Mvp	G	A	7: 126,987,556	A801V	probably benign	Het
Neb	T	C	2: 52,292,695	D1053G	possibly damaging	Het
Nubp1	C	A	16: 10,413,721	L79I	probably benign	Het
Olfr397	G	A	11: 73,965,420	E271K	probably benign	Het
Olfr924	G	A	9: 38,848,509	V132I	probably benign	Het
Olfr97	A	C	17: 37,232,332	L13V	probably benign	Het
Pithd1	A	G	4: 135,977,134		probably benign	Het
Pnpla8	G	A	12: 44,283,405	V29M	probably benign	Het
Psmb2	T	A	4: 126,707,557	I151N	possibly damaging	Het
Ptgs2	C	T	1: 150,101,354	T104I	probably benign	Het
Ptpro	A	G	6: 137,368,079	T28A	probably benign	Het
Raf1	A	G	6: 115,626,710		probably null	Het
Ranbp2	T	C	10: 58,465,529	M668T	probably benign	Het
Rbm48	A	T	5: 3,591,760		probably null	Het
Rhag	A	T	17: 40,831,578	T225S	possibly damaging	Het
Rhof	A	C	5: 123,131,887	L69R	probably damaging	Het
Slc22a1	T	C	17: 12,666,618		probably benign	Het
Slc24a5	T	C	2: 125,068,804	S52P	probably damaging	Het
Slc8a2	T	C	7: 16,141,114	V429A	probably damaging	Het
Spam1	G	A	6: 24,796,887	R279H	probably damaging	Het
Spata16	T	A	3: 26,913,338		probably benign	Het
Srfbp1	A	G	18: 52,487,516	D102G	probably damaging	Het
Srrm3	A	C	5: 135,873,282		probably benign	Het
Tbl1xr1	T	A	3: 22,200,587		probably benign	Het
Tk1	T	C	11: 117,822,107	E98G	probably damaging	Het
Trim13	G	A	14: 61,605,700	V389I	probably benign	Het
Ttc28	A	T	5: 111,235,500	Y1289F	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ugt1a10	T	A	1: 88,056,182	V234D	probably benign	Het
Vmn2r75	C	T	7: 86,165,367	G306E	probably benign	Het
Vmn2r86	C	T	10: 130,453,628	V133I	probably benign	Het
Vps13c	C	A	9: 67,934,476	Q1927K	probably benign	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp219	T	A	14: 52,006,938	T550S	probably benign	Het
Zfp329	T	A	7: 12,811,468	N43I	probably benign	Het

Other mutations in Atrnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Atrnl1	APN	19	57691817	missense	probably benign	0.02
IGL00707:Atrnl1	APN	19	57673265	missense	probably damaging	0.96
IGL00921:Atrnl1	APN	19	57702153	missense	probably damaging	1.00
IGL01410:Atrnl1	APN	19	58131104	missense	probably damaging	1.00
IGL01468:Atrnl1	APN	19	57699712	missense	probably benign	0.02
IGL01756:Atrnl1	APN	19	57652948	missense	probably benign
IGL01971:Atrnl1	APN	19	57753283	missense	probably damaging	1.00
IGL02019:Atrnl1	APN	19	57691763	splice site	probably benign
IGL02580:Atrnl1	APN	19	57714576	splice site	probably benign
IGL02649:Atrnl1	APN	19	57650441	splice site	probably benign
IGL02676:Atrnl1	APN	19	57691884	missense	probably damaging	1.00
IGL03276:Atrnl1	APN	19	57652927	missense	probably damaging	0.99
IGL03379:Atrnl1	APN	19	57642541	missense	probably benign	0.02
Magnetogorsk	UTSW	19	57630306	missense	probably damaging	1.00
polar	UTSW	19	57652950	missense	probably benign	0.00
PIT4812001:Atrnl1	UTSW	19	57731623	missense	probably benign	0.08
R0109:Atrnl1	UTSW	19	57755517	missense	possibly damaging	0.78
R0308:Atrnl1	UTSW	19	57753288	missense	probably benign	0.04
R0394:Atrnl1	UTSW	19	57673176	missense	probably benign	0.10
R0734:Atrnl1	UTSW	19	57654861	missense	probably damaging	1.00
R0812:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R1183:Atrnl1	UTSW	19	57650293	missense	probably damaging	0.97
R1213:Atrnl1	UTSW	19	57638462	missense	probably benign	0.25
R1344:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1418:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1707:Atrnl1	UTSW	19	57686737	missense	probably benign	0.00
R1748:Atrnl1	UTSW	19	57714702	missense	probably damaging	0.99
R2051:Atrnl1	UTSW	19	57691849	missense	probably benign	0.01
R2113:Atrnl1	UTSW	19	57755616	nonsense	probably null
R2130:Atrnl1	UTSW	19	57654994	missense	probably damaging	1.00
R3710:Atrnl1	UTSW	19	57657114	missense	probably damaging	1.00
R3916:Atrnl1	UTSW	19	57935652	missense	possibly damaging	0.82
R4524:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R4707:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4712:Atrnl1	UTSW	19	57652950	missense	probably benign	0.00
R4784:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4785:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4798:Atrnl1	UTSW	19	58042361	missense	probably benign
R5172:Atrnl1	UTSW	19	57685513	nonsense	probably null
R5226:Atrnl1	UTSW	19	57650335	missense	probably benign
R5289:Atrnl1	UTSW	19	57657082	missense	probably damaging	1.00
R5372:Atrnl1	UTSW	19	57755536	missense	probably benign
R5737:Atrnl1	UTSW	19	57777888	missense	possibly damaging	0.84
R5782:Atrnl1	UTSW	19	57753286	missense	possibly damaging	0.95
R5826:Atrnl1	UTSW	19	57630292	nonsense	probably null
R6169:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R6242:Atrnl1	UTSW	19	57642478	missense	probably benign	0.02
R6342:Atrnl1	UTSW	19	57638510	missense	probably damaging	1.00
R6372:Atrnl1	UTSW	19	57650332	missense	probably benign	0.01
R6811:Atrnl1	UTSW	19	57654961	missense	probably damaging	0.98
R6897:Atrnl1	UTSW	19	58042368	missense	probably benign	0.01
R7024:Atrnl1	UTSW	19	57638450	critical splice acceptor site	probably null
R7085:Atrnl1	UTSW	19	57691857	missense	probably damaging	1.00
R7144:Atrnl1	UTSW	19	58042352	missense	probably damaging	1.00
R7259:Atrnl1	UTSW	19	57935606	nonsense	probably null
R7289:Atrnl1	UTSW	19	57650414	missense	probably benign	0.13
R7310:Atrnl1	UTSW	19	57642424	missense	possibly damaging	0.69
R7372:Atrnl1	UTSW	19	57935646	missense	possibly damaging	0.47
R7432:Atrnl1	UTSW	19	57755524	missense	probably damaging	1.00
R7478:Atrnl1	UTSW	19	57696312	missense	possibly damaging	0.89
R7556:Atrnl1	UTSW	19	57654846	missense	probably benign
R7567:Atrnl1	UTSW	19	57699523	missense	probably damaging	0.98
R7608:Atrnl1	UTSW	19	57714687	missense	probably damaging	1.00
R7632:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R7655:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7656:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7718:Atrnl1	UTSW	19	57740183	nonsense	probably null
R7721:Atrnl1	UTSW	19	57696331	missense	probably benign	0.00
R7726:Atrnl1	UTSW	19	57702072	missense	probably damaging	1.00
R7733:Atrnl1	UTSW	19	57701988	missense	probably benign	0.00
R7774:Atrnl1	UTSW	19	57699671	missense	probably damaging	1.00
R8010:Atrnl1	UTSW	19	57682446	missense	probably benign	0.14
R8119:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R9242:Atrnl1	UTSW	19	57657228	missense	probably benign	0.07
R9265:Atrnl1	UTSW	19	57777927	missense	probably benign	0.11
R9272:Atrnl1	UTSW	19	57654988	missense	probably benign	0.00
R9480:Atrnl1	UTSW	19	57701988	missense	possibly damaging	0.61
R9526:Atrnl1	UTSW	19	57629119	missense	probably damaging	0.99
R9672:Atrnl1	UTSW	19	57630263	missense	possibly damaging	0.87
R9673:Atrnl1	UTSW	19	57611354	start codon destroyed	probably null	0.04
RF021:Atrnl1	UTSW	19	57642473	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGACTGGTGTCCTACCTTCAAAAGTGA -3'
(R):5'- GCATGACCACTGTGCTGAAATTAGAGA -3'

Sequencing Primer
(F):5'- TGTCCTACCTTCAAAAGTGAAAAATC -3'
(R):5'- ACAGTCTGTCACTAAACTGATCTCTG -3'

Posted On

2013-10-16