Incidental Mutation 'R0815:Gfm1'
ID 78558
Institutional Source Beutler Lab
Gene Symbol Gfm1
Ensembl Gene ENSMUSG00000027774
Gene Name G elongation factor, mitochondrial 1
Synonyms D3Wsu133e
MMRRC Submission 038995-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0815 (G1)
Quality Score 211
Status Validated
Chromosome 3
Chromosomal Location 67430096-67476529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67474595 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 705 (S705P)
Ref Sequence ENSEMBL: ENSMUSP00000076503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054825] [ENSMUST00000077271]
AlphaFold Q8K0D5
Predicted Effect probably benign
Transcript: ENSMUST00000054825
SMART Domains Protein: ENSMUSP00000056728
Gene: ENSMUSG00000049404

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
Pfam:Latexin 81 299 8e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000077271
AA Change: S705P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076503
Gene: ENSMUSG00000027774
AA Change: S705P

DomainStartEndE-ValueType
Pfam:GTP_EFTU 45 320 3.5e-65 PFAM
Pfam:GTP_EFTU_D2 366 432 6e-18 PFAM
Pfam:EFG_II 446 520 1.9e-31 PFAM
EFG_IV 522 642 1.64e-47 SMART
EFG_C 644 731 2.16e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195639
Meta Mutation Damage Score 0.9580 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors. Its role in the regulation of normal mitochondrial function and in different disease states attributed to mitochondrial dysfunction is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
Abcb5 A G 12: 118,901,449 probably benign Het
Abcf2 A T 5: 24,567,270 Y487N probably damaging Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Atp2a2 T C 5: 122,471,236 I188V probably benign Het
Cacna1s A T 1: 136,112,957 I1231F possibly damaging Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Celsr2 G T 3: 108,401,301 T1770K possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Dpp10 A G 1: 123,432,929 probably null Het
Dscaml1 A G 9: 45,745,074 I1571V probably benign Het
Eif3j2 T A 18: 43,476,971 Y259F probably benign Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fbxo21 T C 5: 117,995,508 probably benign Het
Frmd8 A T 19: 5,865,056 probably benign Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Lipm A T 19: 34,118,761 T326S probably benign Het
Lrrc8c T C 5: 105,608,534 L725P probably damaging Het
Map3k19 A G 1: 127,834,638 probably benign Het
Med31 T A 11: 72,213,831 N50I probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Myo15b T G 11: 115,866,336 probably benign Het
Nemp1 T C 10: 127,693,024 L199S probably damaging Het
Nod2 G A 8: 88,672,662 probably benign Het
Olfr1444 A G 19: 12,862,644 I290V probably benign Het
Olfr319 A G 11: 58,702,609 R303G possibly damaging Het
Parva G A 7: 112,567,864 V215M probably damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Rbm11 C T 16: 75,596,637 R74C probably damaging Het
Robo3 A G 9: 37,422,183 V744A probably damaging Het
Rsbn1 T G 3: 103,954,153 S522A probably damaging Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sec31b G A 19: 44,518,173 Q909* probably null Het
Slc38a11 T A 2: 65,353,780 I176L possibly damaging Het
Slc39a4 C T 15: 76,612,639 D574N probably damaging Het
Slc44a1 T G 4: 53,536,421 V199G possibly damaging Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Son C A 16: 91,655,484 A373D probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Speg A G 1: 75,415,392 Y1606C probably damaging Het
Srgap1 A T 10: 121,785,474 V1061D probably damaging Het
Stat5a A G 11: 100,875,082 probably null Het
Supt4a T A 11: 87,737,583 probably benign Het
Teddm1b A G 1: 153,874,892 K149R possibly damaging Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Upp2 A G 2: 58,771,556 T144A probably benign Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Gfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Gfm1 APN 3 67438560 missense possibly damaging 0.79
IGL01377:Gfm1 APN 3 67474753 missense probably damaging 1.00
IGL01397:Gfm1 APN 3 67443658 missense probably benign 0.09
IGL01738:Gfm1 APN 3 67456661 missense probably benign 0.15
IGL02679:Gfm1 APN 3 67474767 missense possibly damaging 0.56
IGL03271:Gfm1 APN 3 67474743 missense probably damaging 1.00
R0389:Gfm1 UTSW 3 67457918 missense probably benign 0.00
R0863:Gfm1 UTSW 3 67474595 missense probably damaging 1.00
R1626:Gfm1 UTSW 3 67438644 missense probably damaging 1.00
R1843:Gfm1 UTSW 3 67435610 missense probably damaging 1.00
R1931:Gfm1 UTSW 3 67456585 missense probably benign 0.44
R2097:Gfm1 UTSW 3 67449746 missense probably damaging 0.97
R2149:Gfm1 UTSW 3 67474560 missense probably damaging 1.00
R2337:Gfm1 UTSW 3 67435514 missense probably damaging 1.00
R3739:Gfm1 UTSW 3 67456700 missense probably damaging 1.00
R4193:Gfm1 UTSW 3 67431720 missense probably damaging 1.00
R4661:Gfm1 UTSW 3 67433398 missense probably damaging 1.00
R5023:Gfm1 UTSW 3 67473544 missense probably damaging 1.00
R5057:Gfm1 UTSW 3 67473544 missense probably damaging 1.00
R5503:Gfm1 UTSW 3 67453727 critical splice donor site probably null
R5692:Gfm1 UTSW 3 67435622 missense probably damaging 1.00
R5771:Gfm1 UTSW 3 67435562 missense probably benign 0.11
R6232:Gfm1 UTSW 3 67467882 missense possibly damaging 0.52
R6234:Gfm1 UTSW 3 67435514 missense probably damaging 1.00
R6514:Gfm1 UTSW 3 67473546 missense probably benign
R6911:Gfm1 UTSW 3 67451303 missense possibly damaging 0.83
R7295:Gfm1 UTSW 3 67440181 missense probably benign 0.30
R7899:Gfm1 UTSW 3 67473527 missense probably benign 0.10
R8321:Gfm1 UTSW 3 67430261 missense probably benign
R8465:Gfm1 UTSW 3 67431699 missense probably damaging 1.00
R8473:Gfm1 UTSW 3 67453718 missense possibly damaging 0.71
R9745:Gfm1 UTSW 3 67451324 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCCCAACGTGTCTGTCTGTCTG -3'
(R):5'- TCCATCATCCCCAAGTGTGGTAGTC -3'

Sequencing Primer
(F):5'- ctctctctctctctctctctctc -3'
(R):5'- TCCCCAAGTGTGGTAGTCAAATAG -3'
Posted On 2013-10-16