Incidental Mutation 'R0815:Fbxo21'
ID78565
Institutional Source Beutler Lab
Gene Symbol Fbxo21
Ensembl Gene ENSMUSG00000032898
Gene NameF-box protein 21
Synonyms
MMRRC Submission 038995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R0815 (G1)
Quality Score211
Status Validated
Chromosome5
Chromosomal Location117976730-118010201 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 117995508 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035579] [ENSMUST00000202447]
Predicted Effect probably benign
Transcript: ENSMUST00000035579
SMART Domains Protein: ENSMUSP00000035506
Gene: ENSMUSG00000032898

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
Blast:FBOX 33 73 6e-8 BLAST
Pfam:Transglut_core2 215 390 3e-43 PFAM
low complexity region 482 491 N/A INTRINSIC
YccV-like 500 597 8.22e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201611
Predicted Effect probably benign
Transcript: ENSMUST00000202447
SMART Domains Protein: ENSMUSP00000143873
Gene: ENSMUSG00000032898

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
Blast:FBOX 33 73 6e-8 BLAST
Pfam:Transglut_core2 215 390 3e-43 PFAM
low complexity region 482 491 N/A INTRINSIC
YccV-like 500 597 8.22e-39 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
Abcb5 A G 12: 118,901,449 probably benign Het
Abcf2 A T 5: 24,567,270 Y487N probably damaging Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Atp2a2 T C 5: 122,471,236 I188V probably benign Het
Cacna1s A T 1: 136,112,957 I1231F possibly damaging Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Celsr2 G T 3: 108,401,301 T1770K possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Dpp10 A G 1: 123,432,929 probably null Het
Dscaml1 A G 9: 45,745,074 I1571V probably benign Het
Eif3j2 T A 18: 43,476,971 Y259F probably benign Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Frmd8 A T 19: 5,865,056 probably benign Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Lipm A T 19: 34,118,761 T326S probably benign Het
Lrrc8c T C 5: 105,608,534 L725P probably damaging Het
Map3k19 A G 1: 127,834,638 probably benign Het
Med31 T A 11: 72,213,831 N50I probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Myo15b T G 11: 115,866,336 probably benign Het
Nemp1 T C 10: 127,693,024 L199S probably damaging Het
Nod2 G A 8: 88,672,662 probably benign Het
Olfr1444 A G 19: 12,862,644 I290V probably benign Het
Olfr319 A G 11: 58,702,609 R303G possibly damaging Het
Parva G A 7: 112,567,864 V215M probably damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Rbm11 C T 16: 75,596,637 R74C probably damaging Het
Robo3 A G 9: 37,422,183 V744A probably damaging Het
Rsbn1 T G 3: 103,954,153 S522A probably damaging Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sec31b G A 19: 44,518,173 Q909* probably null Het
Slc38a11 T A 2: 65,353,780 I176L possibly damaging Het
Slc39a4 C T 15: 76,612,639 D574N probably damaging Het
Slc44a1 T G 4: 53,536,421 V199G possibly damaging Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Son C A 16: 91,655,484 A373D probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Speg A G 1: 75,415,392 Y1606C probably damaging Het
Srgap1 A T 10: 121,785,474 V1061D probably damaging Het
Stat5a A G 11: 100,875,082 probably null Het
Supt4a T A 11: 87,737,583 probably benign Het
Teddm1b A G 1: 153,874,892 K149R possibly damaging Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Upp2 A G 2: 58,771,556 T144A probably benign Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Fbxo21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Fbxo21 APN 5 117988790 missense probably benign 0.04
IGL02131:Fbxo21 APN 5 118002090 missense possibly damaging 0.76
IGL02156:Fbxo21 APN 5 117994668 splice site probably benign
IGL02195:Fbxo21 APN 5 118002154 missense probably damaging 1.00
IGL02702:Fbxo21 APN 5 118000510 missense probably damaging 1.00
PIT1430001:Fbxo21 UTSW 5 117977866 missense possibly damaging 0.68
R0008:Fbxo21 UTSW 5 118008013 missense possibly damaging 0.63
R0055:Fbxo21 UTSW 5 118000490 missense probably benign 0.12
R0055:Fbxo21 UTSW 5 118000490 missense probably benign 0.12
R0089:Fbxo21 UTSW 5 118008143 missense probably benign
R0101:Fbxo21 UTSW 5 117995456 missense probably damaging 1.00
R0866:Fbxo21 UTSW 5 117977033 missense probably benign 0.01
R1673:Fbxo21 UTSW 5 118008064 missense probably benign 0.27
R2048:Fbxo21 UTSW 5 118008104 missense probably damaging 1.00
R2063:Fbxo21 UTSW 5 117976966 missense probably benign 0.45
R2161:Fbxo21 UTSW 5 117995386 missense probably damaging 1.00
R2224:Fbxo21 UTSW 5 118008123 missense probably damaging 1.00
R3872:Fbxo21 UTSW 5 118000329 missense possibly damaging 0.70
R4750:Fbxo21 UTSW 5 118000468 missense probably benign 0.10
R5807:Fbxo21 UTSW 5 117976868 missense probably benign 0.01
R6075:Fbxo21 UTSW 5 117988883 missense probably damaging 0.97
R6528:Fbxo21 UTSW 5 118000356 missense probably benign 0.25
R7494:Fbxo21 UTSW 5 118000323 missense possibly damaging 0.86
R7498:Fbxo21 UTSW 5 118002174 critical splice donor site probably null
R7801:Fbxo21 UTSW 5 117986124 missense probably damaging 0.96
R7857:Fbxo21 UTSW 5 117988813 missense probably benign 0.21
R7944:Fbxo21 UTSW 5 118008147 missense possibly damaging 0.89
R7945:Fbxo21 UTSW 5 118008147 missense possibly damaging 0.89
R8116:Fbxo21 UTSW 5 117990854 missense possibly damaging 0.70
R8354:Fbxo21 UTSW 5 117995414 missense probably damaging 1.00
R8454:Fbxo21 UTSW 5 117995414 missense probably damaging 1.00
Z1177:Fbxo21 UTSW 5 117989171 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGGTCTGGGAATCGGAAACCTTG -3'
(R):5'- AGCATTGAGCACCTGTCTTGCC -3'

Sequencing Primer
(F):5'- TTGTAGACTTCCACTGAGAAAGCC -3'
(R):5'- ACCAACAGGCATTTCTGGTG -3'
Posted On2013-10-16