Incidental Mutation 'R0815:Nod2'
ID78571
Institutional Source Beutler Lab
Gene Symbol Nod2
Ensembl Gene ENSMUSG00000055994
Gene Namenucleotide-binding oligomerization domain containing 2
SynonymsNlrc2, Card15, F830032C23Rik
MMRRC Submission 038995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R0815 (G1)
Quality Score215
Status Validated
Chromosome8
Chromosomal Location88647315-88688474 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 88672662 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054324] [ENSMUST00000109634] [ENSMUST00000118370]
Predicted Effect probably benign
Transcript: ENSMUST00000054324
SMART Domains Protein: ENSMUSP00000050538
Gene: ENSMUSG00000055994

DomainStartEndE-ValueType
Pfam:CARD 4 92 5.3e-20 PFAM
Blast:CARD 100 177 8e-11 BLAST
Pfam:NACHT 288 458 1.8e-46 PFAM
low complexity region 521 554 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
LRR 781 811 3.15e1 SMART
LRR 813 836 1.12e2 SMART
LRR 837 864 8.53e0 SMART
LRR 865 892 1.58e-3 SMART
LRR 893 920 4.83e-1 SMART
LRR 921 948 1.13e0 SMART
LRR 949 976 4.68e-6 SMART
LRR 977 1004 7.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109634
SMART Domains Protein: ENSMUSP00000105262
Gene: ENSMUSG00000055994

DomainStartEndE-ValueType
Pfam:CARD 11 99 2.5e-22 PFAM
Pfam:CARD 111 195 2.1e-14 PFAM
Pfam:NACHT 273 443 1.2e-45 PFAM
low complexity region 506 539 N/A INTRINSIC
low complexity region 613 624 N/A INTRINSIC
LRR 766 796 3.15e1 SMART
LRR 798 821 1.12e2 SMART
LRR 822 849 8.53e0 SMART
LRR 850 877 1.58e-3 SMART
LRR 878 905 4.83e-1 SMART
LRR 906 933 1.13e0 SMART
LRR 934 961 4.68e-6 SMART
LRR 962 989 7.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118370
SMART Domains Protein: ENSMUSP00000113773
Gene: ENSMUSG00000055994

DomainStartEndE-ValueType
Pfam:CARD 4 92 1e-21 PFAM
Pfam:CARD 104 188 8.4e-14 PFAM
Pfam:NACHT 266 436 2.5e-45 PFAM
low complexity region 499 532 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
LRR 759 789 3.15e1 SMART
LRR 791 814 1.12e2 SMART
LRR 815 842 8.53e0 SMART
LRR 843 870 1.58e-3 SMART
LRR 871 898 4.83e-1 SMART
LRR 899 926 1.13e0 SMART
LRR 927 954 4.68e-6 SMART
LRR 955 982 7.78e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Nod1/Apaf-1 family and encodes a protein with two caspase recruitment (CARD) domains and six leucine-rich repeats (LRRs). The protein is primarily expressed in the peripheral blood leukocytes. It plays a role in the immune response to intracellular bacterial lipopolysaccharides (LPS) by recognizing the muramyl dipeptide (MDP) derived from them and activating the NFKB protein. Mutations in this gene have been associated with Crohn disease and Blau syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology and increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
Abcb5 A G 12: 118,901,449 probably benign Het
Abcf2 A T 5: 24,567,270 Y487N probably damaging Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Atp2a2 T C 5: 122,471,236 I188V probably benign Het
Cacna1s A T 1: 136,112,957 I1231F possibly damaging Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Celsr2 G T 3: 108,401,301 T1770K possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Dpp10 A G 1: 123,432,929 probably null Het
Dscaml1 A G 9: 45,745,074 I1571V probably benign Het
Eif3j2 T A 18: 43,476,971 Y259F probably benign Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fbxo21 T C 5: 117,995,508 probably benign Het
Frmd8 A T 19: 5,865,056 probably benign Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Lipm A T 19: 34,118,761 T326S probably benign Het
Lrrc8c T C 5: 105,608,534 L725P probably damaging Het
Map3k19 A G 1: 127,834,638 probably benign Het
Med31 T A 11: 72,213,831 N50I probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Myo15b T G 11: 115,866,336 probably benign Het
Nemp1 T C 10: 127,693,024 L199S probably damaging Het
Olfr1444 A G 19: 12,862,644 I290V probably benign Het
Olfr319 A G 11: 58,702,609 R303G possibly damaging Het
Parva G A 7: 112,567,864 V215M probably damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Rbm11 C T 16: 75,596,637 R74C probably damaging Het
Robo3 A G 9: 37,422,183 V744A probably damaging Het
Rsbn1 T G 3: 103,954,153 S522A probably damaging Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sec31b G A 19: 44,518,173 Q909* probably null Het
Slc38a11 T A 2: 65,353,780 I176L possibly damaging Het
Slc39a4 C T 15: 76,612,639 D574N probably damaging Het
Slc44a1 T G 4: 53,536,421 V199G possibly damaging Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Son C A 16: 91,655,484 A373D probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Speg A G 1: 75,415,392 Y1606C probably damaging Het
Srgap1 A T 10: 121,785,474 V1061D probably damaging Het
Stat5a A G 11: 100,875,082 probably null Het
Supt4a T A 11: 87,737,583 probably benign Het
Teddm1b A G 1: 153,874,892 K149R possibly damaging Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Upp2 A G 2: 58,771,556 T144A probably benign Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Nod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Nod2 APN 8 88663736 missense probably benign 0.02
IGL02299:Nod2 APN 8 88663742 missense possibly damaging 0.81
PIT4687001:Nod2 UTSW 8 88681646 missense probably damaging 1.00
R0305:Nod2 UTSW 8 88665323 missense probably damaging 1.00
R0391:Nod2 UTSW 8 88663778 missense probably benign 0.00
R0580:Nod2 UTSW 8 88664406 missense probably damaging 1.00
R0617:Nod2 UTSW 8 88653231 missense probably benign 0.00
R1460:Nod2 UTSW 8 88663812 missense probably damaging 1.00
R1528:Nod2 UTSW 8 88664589 missense possibly damaging 0.92
R1707:Nod2 UTSW 8 88670476 missense possibly damaging 0.59
R1934:Nod2 UTSW 8 88663719 missense probably benign
R1956:Nod2 UTSW 8 88664208 missense probably damaging 1.00
R1972:Nod2 UTSW 8 88652873 missense probably damaging 1.00
R1973:Nod2 UTSW 8 88652873 missense probably damaging 1.00
R2902:Nod2 UTSW 8 88675463 missense probably damaging 1.00
R2918:Nod2 UTSW 8 88652891 missense probably benign 0.02
R3435:Nod2 UTSW 8 88664009 missense possibly damaging 0.64
R3705:Nod2 UTSW 8 88653320 missense probably benign 0.02
R4395:Nod2 UTSW 8 88664391 missense probably damaging 1.00
R4612:Nod2 UTSW 8 88665036 missense possibly damaging 0.65
R4756:Nod2 UTSW 8 88664274 missense possibly damaging 0.59
R5122:Nod2 UTSW 8 88664120 missense probably damaging 1.00
R5144:Nod2 UTSW 8 88653066 missense probably damaging 0.99
R5166:Nod2 UTSW 8 88664247 missense possibly damaging 0.58
R5203:Nod2 UTSW 8 88664451 missense probably damaging 1.00
R5338:Nod2 UTSW 8 88672785 intron probably null
R5614:Nod2 UTSW 8 88664196 missense probably damaging 1.00
R5746:Nod2 UTSW 8 88664342 missense probably damaging 0.98
R5834:Nod2 UTSW 8 88664639 missense possibly damaging 0.91
R6059:Nod2 UTSW 8 88664414 missense probably damaging 1.00
R6282:Nod2 UTSW 8 88670460 missense probably benign 0.02
R6707:Nod2 UTSW 8 88665189 missense probably benign
R6741:Nod2 UTSW 8 88653066 missense probably damaging 0.99
R6838:Nod2 UTSW 8 88670458 missense possibly damaging 0.63
R7008:Nod2 UTSW 8 88663657 nonsense probably null
R7182:Nod2 UTSW 8 88663832 missense probably benign 0.01
R7324:Nod2 UTSW 8 88653066 missense probably damaging 1.00
R7344:Nod2 UTSW 8 88660582 missense probably damaging 1.00
R7588:Nod2 UTSW 8 88674908 missense possibly damaging 0.80
R7625:Nod2 UTSW 8 88665278 missense probably damaging 0.98
R7915:Nod2 UTSW 8 88660797 intron probably null
Z1088:Nod2 UTSW 8 88664146 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAATTGCTGTGCCCCTGTGACC -3'
(R):5'- GGAAAGCCCCACATTCCTTCATGC -3'

Sequencing Primer
(F):5'- TCCCTTCAGAATAGGCCAGTG -3'
(R):5'- ATGCACACCCTCTATCTCTGAAG -3'
Posted On2013-10-16