Incidental Mutation 'R0815:Abcb5'
ID78584
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 5
Synonyms9230106F14Rik
MMRRC Submission 038995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R0815 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location118867824-118966421 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 118901449 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
Predicted Effect probably benign
Transcript: ENSMUST00000035515
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100982
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
Abcf2 A T 5: 24,567,270 Y487N probably damaging Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Atp2a2 T C 5: 122,471,236 I188V probably benign Het
Cacna1s A T 1: 136,112,957 I1231F possibly damaging Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Celsr2 G T 3: 108,401,301 T1770K possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Dpp10 A G 1: 123,432,929 probably null Het
Dscaml1 A G 9: 45,745,074 I1571V probably benign Het
Eif3j2 T A 18: 43,476,971 Y259F probably benign Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fbxo21 T C 5: 117,995,508 probably benign Het
Frmd8 A T 19: 5,865,056 probably benign Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Lipm A T 19: 34,118,761 T326S probably benign Het
Lrrc8c T C 5: 105,608,534 L725P probably damaging Het
Map3k19 A G 1: 127,834,638 probably benign Het
Med31 T A 11: 72,213,831 N50I probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Myo15b T G 11: 115,866,336 probably benign Het
Nemp1 T C 10: 127,693,024 L199S probably damaging Het
Nod2 G A 8: 88,672,662 probably benign Het
Olfr1444 A G 19: 12,862,644 I290V probably benign Het
Olfr319 A G 11: 58,702,609 R303G possibly damaging Het
Parva G A 7: 112,567,864 V215M probably damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Rbm11 C T 16: 75,596,637 R74C probably damaging Het
Robo3 A G 9: 37,422,183 V744A probably damaging Het
Rsbn1 T G 3: 103,954,153 S522A probably damaging Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sec31b G A 19: 44,518,173 Q909* probably null Het
Slc38a11 T A 2: 65,353,780 I176L possibly damaging Het
Slc39a4 C T 15: 76,612,639 D574N probably damaging Het
Slc44a1 T G 4: 53,536,421 V199G possibly damaging Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Son C A 16: 91,655,484 A373D probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Speg A G 1: 75,415,392 Y1606C probably damaging Het
Srgap1 A T 10: 121,785,474 V1061D probably damaging Het
Stat5a A G 11: 100,875,082 probably null Het
Supt4a T A 11: 87,737,583 probably benign Het
Teddm1b A G 1: 153,874,892 K149R possibly damaging Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Upp2 A G 2: 58,771,556 T144A probably benign Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118890610 missense probably benign 0.03
IGL00092:Abcb5 APN 12 118928695 missense probably benign 0.09
IGL00503:Abcb5 APN 12 118907601 missense probably benign 0.02
IGL00776:Abcb5 APN 12 118919854 missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118886176 missense probably benign
IGL01302:Abcb5 APN 12 118918200 missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118872867 missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118867970 missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118911434 missense probably benign 0.03
IGL01784:Abcb5 APN 12 118890664 missense probably benign 0.14
IGL01967:Abcb5 APN 12 118867972 missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118927358 missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118940680 missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118874755 missense probably benign
IGL02292:Abcb5 APN 12 118918197 missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118940678 missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118906268 splice site probably benign
IGL02685:Abcb5 APN 12 118905947 missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118890685 missense probably benign 0.05
IGL02876:Abcb5 APN 12 118919841 missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118944939 missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118940369 missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118936087 missense probably benign 0.43
IGL03200:Abcb5 APN 12 118965254 splice site probably benign
IGL03407:Abcb5 APN 12 118940376 missense probably benign 0.01
F5770:Abcb5 UTSW 12 118886179 missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118936098 missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118890687 missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118927394 missense probably benign
R0219:Abcb5 UTSW 12 118886150 splice site probably benign
R0312:Abcb5 UTSW 12 118872837 missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118965251 splice site probably benign
R0359:Abcb5 UTSW 12 118940332 missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118877810 missense probably benign 0.03
R0582:Abcb5 UTSW 12 118940412 missense probably benign 0.40
R0900:Abcb5 UTSW 12 118940624 missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118906198 missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118932575 missense probably benign 0.36
R1125:Abcb5 UTSW 12 118911547 missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118874762 missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118965329 start gained probably benign
R1726:Abcb5 UTSW 12 118874801 splice site probably null
R1726:Abcb5 UTSW 12 118907532 missense possibly damaging 0.95
R1836:Abcb5 UTSW 12 118867961 missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118907500 splice site probably null
R1976:Abcb5 UTSW 12 118890682 missense probably benign
R2005:Abcb5 UTSW 12 118877827 missense probably benign 0.15
R2068:Abcb5 UTSW 12 118940568 nonsense probably null
R2181:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118867956 missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118872933 missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118874620 missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118901352 splice site probably null
R3919:Abcb5 UTSW 12 118890618 missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118868669 missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118872922 missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118932610 critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118965305 missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118911434 missense probably benign 0.03
R4966:Abcb5 UTSW 12 118886891 intron probably benign
R5169:Abcb5 UTSW 12 118877817 nonsense probably null
R5327:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R5333:Abcb5 UTSW 12 118867942 missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118867930 missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118887177 missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118911499 missense probably benign
R5416:Abcb5 UTSW 12 118907596 missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118927326 missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118940690 missense probably null 1.00
R5566:Abcb5 UTSW 12 118935967 missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118932613 splice site probably null
R5691:Abcb5 UTSW 12 118927235 missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118918257 missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118927404 missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118868781 nonsense probably null
R5994:Abcb5 UTSW 12 118965260 critical splice donor site probably null
R6295:Abcb5 UTSW 12 118874644 missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118890549 critical splice donor site probably null
R6609:Abcb5 UTSW 12 118928762 missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118944906 missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118901354 splice site probably null
R6870:Abcb5 UTSW 12 118965265 missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118911530 missense probably benign 0.06
R6957:Abcb5 UTSW 12 118907535 missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118927277 missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118931925 missense probably benign 0.00
R7061:Abcb5 UTSW 12 118877774 missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118867876 missense probably benign 0.00
R7239:Abcb5 UTSW 12 118928725 missense probably benign 0.19
R7267:Abcb5 UTSW 12 118952470 missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118911560 missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118867874 missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118918164 missense probably damaging 1.00
R7989:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R8177:Abcb5 UTSW 12 118872790 missense possibly damaging 0.65
R8296:Abcb5 UTSW 12 118874732 missense probably benign 0.01
R8544:Abcb5 UTSW 12 118868726 missense probably damaging 1.00
R8558:Abcb5 UTSW 12 118877831 missense probably benign 0.07
R8790:Abcb5 UTSW 12 118867885 missense possibly damaging 0.91
V7580:Abcb5 UTSW 12 118886179 missense probably benign 0.07
Z1176:Abcb5 UTSW 12 118918272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCCTCAGAGTGCTGTTAAGA -3'
(R):5'- TGGTAACGAGTCCACAGTCAGTCT -3'

Sequencing Primer
(F):5'- gggaaaagccaccttccac -3'
(R):5'- TGCTTACTGGCAGGTGAGAAG -3'
Posted On2013-10-16